AJP - GI Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 281: G931-G939, 2001;
0193-1857/01 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (69)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Frazer, D. M.
Right arrow Articles by Anderson, G. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Frazer, D. M.
Right arrow Articles by Anderson, G. J.
Vol. 281, Issue 4, G931-G939, October 2001

Cloning and gastrointestinal expression of rat hephaestin: relationship to other iron transport proteins

David M. Frazer1, Christopher D. Vulpe2, Andrew T. McKie3, Sarah J. Wilkins1, Deborah Trinder4, Geoffrey J. Cleghorn5, and Gregory J. Anderson1

1 Joint Clinical Sciences Program, The Queensland Institute of Medical Research and The University of Queensland, PO Royal Brisbane Hospital and 5 Department of Pediatrics and Child Health, University of Queensland, Brisbane, Queensland 4029; and 4 Department of Medicine, The University of Western Australia, Fremantle Hospital, Fremantle, Western Australia 6160, Australia; 2 Department of Nutritional Sciences, University of California, Berkeley, California 94720; and 3 Department of Molecular Medicine, King's College, London SE59NU, United Kingdom


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

The membrane-bound ceruloplasmin homolog hephaestin plays a critical role in intestinal iron absorption. The aims of this study were to clone the rat hephaestin gene and to examine its expression in the gastrointestinal tract in relation to other genes encoding iron transport proteins. The rat hephaestin gene was isolated from intestinal mRNA and was found to encode a protein 96% identical to mouse hephaestin. Analysis by ribonuclease protection assay and Western blotting showed that hephaestin was expressed at high levels throughout the small intestine and colon. Immunofluorescence localized the hephaestin protein to the mature villus enterocytes with little or no expression in the crypts. Variations in iron status had a small but nonsignificant effect on hephaestin expression in the duodenum. The high sequence conservation between rat and mouse hephaestin is consistent with this protein playing a central role in intestinal iron absorption, although its precise function remains to be determined.

divalent metal transporter-1; Ireg1; absorption; intestine


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

IRON IS ESSENTIAL for many aspects of life including oxygen transport, energy production, and a wide range of enzymatic reactions (8, 9, 21). Despite its importance, excess iron can catalyze the formation of oxygen free radicals that can damage cellular components (9). For this reason, organisms must tightly regulate the amount of iron within their cells to provide sufficiently for their biological needs without allowing excess iron to accumulate. The human body can excrete many nutrients, but it has a limited capacity to excrete iron, so body iron stores are regulated at the point of absorption in the proximal small intestine (22). Despite the importance of intestinal absorption in the regulation of body iron status, it is only in recent years that some of the molecular details of intestinal iron transport have been revealed.

One of the first components of the iron absorption pathway to be discovered was the brush border iron transporter divalent metal transporter-1 [DMT1; formerly natural resistance-associated macrophage protein-2 (NRAMP2) or divalent cation transporter 1 (DCT1)] (13, 17). The expression of DMT1 in the small intestine was found to be highly dependent on body iron status, being increased in iron deficiency and decreased under iron-replete conditions. Subsequent studies have indicated that at least two alternatively spliced transcripts of DMT1 exist, and one of these contains a consensus iron responsive element (IRE) motif (19). The IRE splice variant [DMT1(IRE)] is expressed at a much higher level in the duodenum than the non-IRE splice variant [DMT1(non-IRE)] (15, 19), leading to the suggestion that the iron-regulated expression of DMT1 may be mediated via iron regulatory proteins (IRPs) (reviewed by Kühn, Ref. 18). Another of the proteins implicated in the regulation of intestinal iron absorption is the hemochromatosis protein (HFE). The HFE gene is defective in patients with the iron overload disease hemochromatosis (11), but how this abnormality leads to the increased iron absorption associated with this disorder is unclear.

Another gene associated with intestinal iron transport, hephaestin (Hp), was cloned as the gene defective in sex-linked anemic (sla) (35) mice. This strain of mouse develops a microcytic, hypochromic anemia as a result of a diminished transfer of iron across the basolateral membrane of the mature enterocyte (3, 4, 28, 29). The Hp gene was found to encode a protein with a single predicted membrane-spanning domain and extensive homology to the copper-containing serum ferroxidase ceruloplasmin (Cp) (35). Cp is involved in the release of iron from various body tissues (20, 26, 30), and it is postulated that Hp plays a role in the release of iron from the basolateral membrane of the enterocyte. The predicted structure of Hp suggests that it is not a basolateral transporter itself, but rather acts in conjunction with another protein to transport iron across the basolateral membrane. A candidate basolateral iron transporter with which Hp may associate has been reported recently by three groups and has been termed Ireg1 (iron regulated) (23), ferroportin1 (10), or metal transporter protein-1 (MTP1) (1).

Knowledge of how Hp and other recently recognized proteins of iron metabolism contribute to the process of iron absorption is rudimentary, and the rat provides an ideal experimental organism for studying the physiology of this process. We report here the cloning of the rat Hp gene and its expression in various tissues with particular emphasis on the gastrointestinal tract. Hp is expressed throughout the small intestine and colon, a pattern quite distinct from that of the iron transporters DMT1 and Ireg1, where high expression is restricted to the duodenum (7, 10, 23), the major site of iron absorption. Although changes in body iron status have a major impact on DMT1 and Ireg1 expression (7, 10, 17, 23), we found that the effect on Hp expression was negligible. These results support a role for Hp in the intestinal absorption of iron.


    METHODS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Animals and diets. Adult male Sprague-Dawley rats were used for all experiments. The rats were divided into three experimental groups: 1) iron-deficient animals received an iron-deficient diet as described by Valberg et al. (34), and these animals were allowed access to unlimited quantities of deionized water; 2) control animals received the same iron-deficient base diet supplemented with 750 mg/kg of ferrous ammonium sulfate; 3) iron-loaded animals received the iron-deficient base diet supplemented with 1% wt/wt (dry wt) carbonyl iron. The animals in groups 2 and 3 were allowed access to unlimited quantities of tap water. All animals were weaned onto these diets at 3 wk of age and maintained on them for 6 wk. All experiments described in this study were approved by the Bancroft Centre Research Ethics Committee.

Assessment of iron status. To determine the iron status of the animals in each experimental group, animals were anesthetized (44 mg/kg ketamine and 8 mg/kg xylazine), and blood was withdrawn from the abdominal aorta. Hemoglobin levels were measured using a Cell-Dyn 1600 automated blood analyzer (Abbott Laboratories, Brisbane, Queensland, Australia), and transferrin saturation was determined using an Iron and Iron Binding Capacity Kit (Sigma-Aldrich, Sydney, Australia). In addition, a small amount of liver was removed, dried to constant weight at 110°C, and wet ashed, and the hepatic iron concentration was determined by atomic absorption spectrometry (5).

Evaluation of iron absorption. Intestinal iron absorption was measured in rats from each experimental group to confirm that dietary-induced changes in body iron status resulted in a change in absorption. After an overnight fast, rats were given an intragastric dose of iron consisting of 1 mg/ml of ferrous sulfate in 10 mM HCl containing 12 µCi/ml of 59Fe in a volume of 250 µl. After dosing, the total 59Fe administered to each animal was measured with the use of a Ram DA Counter with PM-11 tube (Rotem Industries, Arava, Israel) at a distance of 20 cm. Each rat was again measured after 5 days, and results are expressed as the proportion of the initial dose retained at this time.

Extraction of RNA. Tissue samples were excised and snap frozen in liquid nitrogen. Total RNA was extracted with the use of TRIzol reagent (Life Technologies, Melbourne, Australia) as per the manufacturer's instructions. RNA integrity was confirmed using formaldehyde gel electrophoresis, and the concentration of each sample was determined by ultraviolet spectrophotometry (31).

Cloning a rat Hp cDNA. The 3' end of the rat Hp transcript was cloned using 3' rapid amplification of cDNA ends (RACE). Total RNA (5 µg) from rat duodenum was reverse transcribed using Superscript II RNase H- reverse transcriptase (Life Technologies) and 20-200 fmol of the RACE-1 primer (ACGAATTCTCGAGCCATGGCTTTTTTTTTTTTTTTA/G/C) as per the manufacturer's instructions. All subsequent PCR reactions contained the following components unless otherwise stated: PCR buffer (Perkin-Elmer, Melbourne, Australia), 1.5 mM MgCl2, 12.5 pmol of each primer, and 5 units Amplitaq (Perkin-Elmer) in a 20-µl reaction volume. PCR reactions were carried out using a DNA thermal cycler (Perkin-Elmer) with the following cycle conditions unless otherwise stated: 94°C denaturation for 5 min, 35 cycles of 1-min denaturation at 94°C, 1-min annealing at 58°C, and 2-min extension at 72°C, followed by a final 10-min extension at 72°C. All gene-specific primers were designed using the murine Hp sequence (GenBank accession no. AF082567). First-round PCR was carried out with the use of 2.5 pmol each of the RACE-2 primer (ACGAATTCTCGAGCCATGGC) and the primer HEPH-FOR (TGTGACTGCTGAGATGGTGC) and 1 µl of the reverse transcription reaction as template. To determine the approximate size of the 3' Hp sequence, the first-round PCR products were analyzed by Southern hybridization with a radiolabeled Hp probe generated using a random primed DNA labeling kit (Roche Molecular Biochemicals, Sydney, Australia) as per the manufacturer's instructions. The probe template was synthesized from rat intestinal cDNA using PCR and the HEPH-FOR and HEPH-REV (TGCAGCAGAGAAGTACATCC) primers. After sizing, the first-round PCR was repeated, and the resulting products were electrophoresed on a 1% Tris-acetate-EDTA agarose gel. The area corresponding to the estimated size of the largest specific band on the probed membrane was excised and purified using a Qiaquick gel extraction kit (Qiagen, Melbourne, Australia) as per the manufacturer's instructions. Nested PCR was then carried out using the RACE-2 primer and the primer pcv6L (GCCCCATGGTGTCTTTTATG) with the use of 1 µl of the gel-purified first-round PCR product as template and 15 units of Amplitaq. The resulting 2.7-kb product was subcloned with the use of the pGEM-T Vector System (Promega, Sydney, Australia) as per the manufacturer's instructions and sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer). The 5' end of the rat Hp transcript was amplified by PCR using the primers HEPH-FOR and HEPH-REV with the use of a 66°C annealing temperature and pcv31 (GTCACTCCTTCCAGGCTGAG) and MHPpCV20 (TGACGAACTTTGCCAGTGAG) with an annealing temperature of 58°C. The PCR products were cloned and sequenced as described above. In all cases, at least three separate clones were sequenced to correct for any PCR errors.

RNase protection assays. RNase protection assays (RPAs) were performed on total RNA using riboprobes corresponding to the following cDNA sequences (the data presented in parentheses indicate section of cDNA and GenBank accession no., respectively): Hp (nt 1360-1573, AF246120), Ireg1 (nt 1190-1365, U76714), DMT1(non-IRE) (nt 1413-1690, AF029757), DMT1(IRE) (nt 1413-1628, AF029757), TfR (nt 1457-1617, M58040), HFE (nt 487-720, AJ001517), and GAPDH (nt 536-691, AF106860), where TfR is transferrin receptor and GAPDH is glyceraldehyde-3-phosphate dehydrogenase. Riboprobe synthesis was performed using the Riboprobe Combination System-SP6/T7 RNA polymerase kit (Promega) as per the manufacturer's instructions with the following modifications. Each transcription contained 17.5 µM cold UTP and 50 µCi [alpha -32P]UTP (3,000 Ci/mmol; NEN, North Ryde, Australia). As GAPDH expression is high in most tissues, the specific activity of the GAPDH riboprobe was reduced by decreasing the amount of [alpha -32P]UTP to 10 µCi and increasing the cold UTP to 120 µM. After synthesis, the template was digested with 1 unit RQ1 RNase-free DNase1 (Promega), and the riboprobe was electrophoresed on a 6% polyacrylamide-50% urea gel for 3 h at 200 V. After electrophoresis, the riboprobes were excised from the gel and eluted for 4 h at 37°C in 400 µl of elution buffer (2 M ammonium acetate, 1% SDS, and 25 µg/ml tRNA). The riboprobes were ethanol precipitated and resuspended in 50 µl of hybridization buffer (40 mM PIPES, pH 6.4, 400 mM NaCl, 1 mM EDTA, and 80% formamide). The specific activity of each probe was determined by liquid scintillation counting. The RNA samples (5-10 µg) were hybridized overnight with 105 counts/min (cpm) of each probe and 2.5 × 104 cpm of GAPDH probe at 45°C in hybridization buffer. After hybridization, the unprotected RNA was digested by addition of 350 µl of RNase digestion buffer (10 mM Tris · HCl, pH 7.5, 300 mM NaCl, and 5 mM EDTA) containing 80 µg/ml of RNase A (Roche Molecular Biochemicals) and 80 U/ml RNase T1 (Roche Molecular Biochemicals) and incubation at 37°C for 1 h. The reaction was stopped by addition of 10 µl of 20% SDS and 2.5 µl of 10 mg/ml of proteinase K (Roche Molecular Biochemicals) and incubation at 37°C for 15 min. The reactions were phenol-chloroform-isoamyl alcohol extracted and precipitated with ethanol. The pellet was resuspended in 5 µl of loading buffer (80% formamide, 15% glycerol, and 0.25% bromophenol blue) and electrophoresed on a 6% polyacrylamide-50% urea gel for 4 h at 200 V. After electrophoresis, the gel was dried onto 3MM chromatography paper (Whatman International, Maidstone, England) and exposed to X-ray film for 2-96 h.

Production of Hp antibody. A 15-amino acid peptide (QHRQRKLRRNRRSIL) in the COOH-terminal region of Hp was synthesized. The peptide was conjugated to keyhole limpet hemocyanin, and the conjugate was used to immunize rabbits. The serum obtained was then affinity purified using the peptide. DMT1 antibody was synthesized by use of a peptide (CVKPSQSQVLRGMFV) corresponding to amino acids 230-243 of the protein as previously described (33).

Western blot analysis. Rats were killed as described above, and enterocytes were isolated as described previously (2). Protein was extracted by resuspension of cell pellets in 5 volumes of 50 mM Tris · HCl buffer (pH 8.0) containing 0.1% SDS, 1% NP-40, 0.5% sodium deoxycholate, and protease inhibitors (Complete; Roche Molecular Biochemicals) and incubation on ice for 20 min. Insoluble material was removed by centrifugation at 16,000 g for 5 min at 4°C, and the protein concentration of the supernatant was determined using the bicinchoninic acid (BCA) method (Pierce Chemical, Rockford, IL). Samples (20 µg) were diluted in sample buffer (50 mM Tris, pH 6.8, 2% SDS, 10% glycerol, 0.1% bromophenol blue, and 5% beta -mercaptoethanol) and heated for 5 min at 95°C before SDS-PAGE on an 8% gel and subsequent transfer to a polyvinylidene difluoride membrane (NEN). Equal transfer of proteins was confirmed by Ponceau S staining. After transfer, the membrane was blocked overnight at 4°C in blocking buffer (20 mM Tris, pH 7.6, 125 mM NaCl, 0.5% Tween 20, and 10% skim milk powder). The remaining incubations were carried out at room temperature. The membrane was rinsed in two changes of washing buffer (20 mM Tris, pH 7.6, 125 mM NaCl, 0.5% Tween 20, and 0.5% skim milk powder), incubated once for 15 min and twice for 5 min in fresh washing buffer, and then incubated with primary antibody (1:5,000) for 1 h. After two washes in washing buffer, the membrane was incubated for 15 min in high-salt buffer (20 mM Tris, pH 7.6, and 0.5 M NaCl), washed twice for 5 min in washing buffer, and then incubated for 30 min in blocking buffer containing peroxidase-conjugated anti-rabbit IgG (1:1,000) (Silenus Laboratories, Melbourne, Australia). The membrane was then rinsed twice in washing buffer, incubated for 15 min in high-salt buffer, and washed four times for 5 min in washing buffer. The signal was visualized with the use of a Western Blot Chemiluminescence Reagent Plus Kit (NEN) as per the manufacturer's instructions and detected by autoradiography. The intensity of the specific bands was determined by densitometry with the use of ImageQuant software (Molecular Dynamics, Sunnyvale, CA). To ensure even loading of the samples, duplicate gels were probed with rabbit anti-actin (Sigma-Aldrich) as the primary antibody at a 1:1,000 dilution.

Immunofluoresence. Hp protein was localized by immunofluorescence using sections cut from duodenal tissue snap frozen in OCT Embedding Compound (Sakura Finetek, Torrance, CA) using liquid nitrogen. All incubations were carried out at room temperature. Sections (5-6 µm thick) were fixed in chloroform-acetone (1:1) for 5 min and stored at -20°C until required. Before use, the sections were thawed and rehydrated in 20 mM phosphate-buffered isotonic saline (PBS). After rehydration, the sections were blocked in 10% goat serum in PBS for 30 min. The tissue was washed with PBS (3 × 5 min) and incubated for 1 h in the primary antibody diluted in PBS (1:100). This was followed by washes in PBS (3 × 5 min). The antibody was detected by incubation of the sections in FITC-conjugated AffiniPure goat anti-rabbit IgG (1:100 in PBS; Jackson Immunoresearch, West Grove, PA) for 30 min. After washes in PBS (3 × 5 min), the sections were mounted in Vectorshield fluorescence mounting medium (Vector Laboratories, Burlingame, CA). Hp localization was observed and photographed using a Bio-Rad MRC 600 confocal microscope. Controls were performed by omitting the primary antibody.

Statistical analysis. All values are expressed as means ± SE. Statistical differences between means were calculated with Microsoft Excel using Student's t-test, correcting for differences in sample variance.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

Determination of the rat Hp sequence. Using a combination of 3' RACE and homology cloning, we have cloned and sequenced 4,260 bp of the rat Hp cDNA encompassing the entire coding region and 3' untranslated region (Fig. 1). This sequence (accession no. AF246120) contains an open reading frame of 3,474 bp encoding a protein of 1,157 amino acids with a single predicted transmembrane domain. Rat Hp is 96% identical and 98% similar to the mouse Hp at the amino acid level. The short cytoplasmic tail is 100% conserved between rat and mouse and may have some functional significance. Like mouse Hp, rat Hp shows extensive homology with Cp, and all residues involved in copper binding and disulfide bond formation are completely conserved (Fig. 1). Rat Hp is 50% identical and 68% similar to rat Cp (14).


View larger version (96K):
[in this window]
[in a new window]
 
Fig. 1.   Amino acid sequence of rat hephaestin (Hp) and comparison with mouse Hp and rat ceruloplasmin (Cp) sequences. The rat sequence is derived from the rat Hp cDNA, whereas the mouse Hp and rat Cp sequences were obtained from GenBank (accession nos. AF082567 and L33869, respectively). The comparison was carried out using the Genetics Computer Group PILEUP program (accessed via the Australian National Genomic Information Service). Residues involved in copper binding and disulfide bond formation in Cp are shown by reverse shading and gray shading, respectively. The predicted transmembrane domain is underlined, and the single amino acid difference between the rat and mouse sequences in this region is indicated by an asterisk (*).

Expression of Hp and other genes encoding iron transport proteins in body tissues. The mRNA levels for Hp and other genes encoding proteins involved in iron transport were examined by RPA in a variety of rat tissues (Fig. 2). Hp mRNA was expressed in a limited subset of tissues with very high expression in the duodenum. High expression of Hp was also found in the colon, and low levels were observed in several other tissues. Ireg1 exhibited a somewhat different expression pattern. Highest expression was seen in the small intestine, but significant levels were also detected in spleen, liver, and placenta. These data are consistent with Ireg1 playing a role in iron export from both the duodenum and other tissues. DMT1(IRE) showed maximal expression in the duodenum but was also highly expressed in the kidney and placenta. The non-IRE splice variant of DMT1 showed quite uniform expression in all tissues tested. HFE message was detected at very low levels in all tissues; however, relatively much higher levels were detected in liver. TfR mRNA was also detected in all tissues tested with maximal expression in the placenta.


View larger version (86K):
[in this window]
[in a new window]
 
Fig. 2.   Expression of Hp and other iron transport genes in rat tissues. mRNA levels were determined by RNase protection assays (RPAs) using 5 µg of total RNA for Hp and Ireg1 riboprobes and 10 µg of total RNA for all other probes as described in METHODS. Representative RPAs are shown for each gene. Because of variations in expression between the genes, the dried gels were autoradiographed for varying times, and exposure times are indicated at right. DMT1, divalent metal transporter-1; IRE, iron responsive element; DMT1(IRE), IRE splice variant; DMT1(non-IRE), non-IRE splice variant; HFE, gene mutated in hemochromatosis; TfR, transferrin receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; d, day.

Expression and localization of Hp in the gastrointestinal tract. The surprisingly high levels of Hp mRNA expression in the colon prompted us to examine the gastrointestinal distribution of this gene in more detail and to compare its expression with other recently described genes involved in iron metabolism. The expression of Hp mRNA was found to be consistently high along the full length of the small intestine with lower, but still significant, levels in the colon (Fig. 3A). Expression of Hp protein in the distal small intestine and colon was confirmed by Western blot analysis (Fig. 3B), which detected a band with an approximate relative molecular weight (Mr) of 155,000. In contrast, the message levels for Ireg1 and DMT1(IRE) were very high in the duodenum but decreased substantially in the distal parts of the small intestine. DMT1(non-IRE) was also expressed at higher levels in the duodenum than at other sites, but overall its expression was very uniform in the gastrointestinal tract. HFE was expressed at low levels throughout the gastrointestinal tract, although a slight increase in expression was observed in the cecum and colon compared with the small intestine. TfR exhibited a similar expression pattern to HFE; however, the level of expression was much higher.


View larger version (48K):
[in this window]
[in a new window]
 
Fig. 3.   Expression of Hp and other iron transport genes in the rat gastrointestinal tract. mRNA levels were determined by RPAs using 5 µg of total RNA for Hp and Ireg1 riboprobes and 10 µg of total RNA for all other probes as described in METHODS. Western blots were performed to determine Hp protein levels using 20 µg of protein as described in METHODS. Tissue was obtained from cardiac stomach (S1), pyloric stomach (S2), duodenum (D), midjejunum (J1), distal jejunum (J2), proximal ileum (I2), distal ileum (I1), cecum (C), ascending colon (C1), transverse colon (C2), and descending colon (C3). Samples from the small intestine were taken at 20-cm intervals starting 1 cm below the pyloric sphincter. A: representative RPAs for each gene. Because of variations in expression between the genes, the dried gels were autoradiographed for varying times, and exposure times are indicated at right. B: representative Western blots for Hp. Because of the limited expression of Hp mRNA in stomach, these samples were not analyzed for protein levels. Actin was used as a loading control. Nos. at right indicate the relative molecular weight of protein standards (×10-3). C: relative expression of each gene in the duodenum. Levels of each mRNA are expressed in relation to GAPDH expression. The data represent means ± SE of 3 separate experiments. Heph, hephaestin.

Immunofluorescence for Hp revealed a villus-specific expression with little or no protein detected in the crypts (Fig. 4). The intracellular location of Hp in the mature enterocytes appeared to be supranuclear with no staining evident on the basolateral membranes. This expression pattern was seen in both the proximal and distal small intestine and did not change in response to variations in body iron status (data not shown).


View larger version (94K):
[in this window]
[in a new window]
 
Fig. 4.   Localization of Hp by immunofluorescence. Tissues were prepared as described in METHODS, and Hp protein was detected using a rabbit polyclonal antibody. Hp was found predominantly in a supranuclear region in the mature villus enterocytes of the duodenum (arrow) (A) with little or no protein detected in the cells of the crypts (C). Negative controls were performed by omitting the primary antibody (B and D). Sections were then examined using cofocal microscopy under high magnification (original magnification, ×400).

The relative abundance of the mRNAs for various iron transport proteins in the duodenum is shown in Fig. 3C. Although only semiquantitative, these data clearly show that the genes encoding the three proteins likely to play direct roles in iron absorption [Hp, Ireg1, and DMT1(IRE)] are expressed at the highest levels. The expression of HFE in the duodenum is very low under these conditions relative to the other genes.

Expression patterns in response to alterations in body iron status. From the phenotype of the sla mouse, Hp is proposed to play a role in the export of iron from mature enterocytes and therefore make an important contribution to intestinal iron absorption. Because absorption is strongly regulated by iron stores, we examined the effect of altering body iron status on the expression of Hp and other genes of iron metabolism in the rat duodenum. Rats were maintained on diets of varying iron content for several weeks to generate animals of differing iron status. Hemoglobin, transferrin saturation, hepatic iron content, and the percentage of a test dose of iron absorbed by the intestine, respectively, for the experimental groups were as follows (all values represent means ± SE, n = 3): control group (14.5 ± 0.5 g/dl, 24.4 ± 5.7%, 9.1 ± 2.4 µmol/g dry wt, and 10.6 ± 3.5%), iron-deficient group (8.0 ± 0.2 g/dl, 2.8 ± 1.1%, 1.1 ± 0.1 µmol/g dry wt, and 52.8 ± 4.9%), and iron-loaded group (16.6 ± 0.7 g/dl, 32.8 ± 5.1%, 90.3 ± 3.7 µmol/g dry wt, and 2.6 ± 0.6%). Representative RPAs showing the expression of Hp, Ireg1, DMT1(IRE), DMT1(non-IRE), HFE, and TfR are presented in Fig. 5A. The level of Hp mRNA was found to increase slightly as the animals became iron deficient. This was also observed at the protein level, although the difference was not found to be statistically significant (Fig. 5B). Ireg1 mRNA was upregulated approximately twofold in iron-deficient rats compared with controls, with a slight downregulation in the iron-loaded animals. In contrast to these relatively minor changes in gene expression, the level of DMT1(IRE) mRNA and DMT1 protein was found to be upregulated dramatically in iron-deficient animals compared with controls. A slight upregulation of DMT1(non-IRE) mRNA was also seen under iron-deficient conditions. Whereas the expression of most genes was increased in iron deficiency and decreased in iron loading, the opposite pattern was seen for HFE mRNA, with a slight decrease in gene expression in response to iron deficiency. Similar results have been reported previously for HFE protein expression in gut biopsies from iron-deficient patients (6).


View larger version (59K):
[in this window]
[in a new window]
 
Fig. 5.   Effect of body iron status on the expression of iron transport genes in the duodenum. mRNA levels were determined by RPAs using 10 µg of total RNA as described in METHODS. Western blots were performed to determine Hp protein levels using 20 µg of protein as described in METHODS. Duodenal tissue was obtained from control (C), iron-deficient (D), and iron-loaded rats (L). A: representative RPAs for each gene. Because of variations in expression between the genes, the dried gels were autoradiographed for varying times, and exposure times are indicated at right. B: representative Western blots for Hp. Actin was used as a loading control, and DMT1 was used as an example of a protein showing iron-dependent regulation of expression. Nos. at right indicate the relative molecular weights of protein standards (×10-3). The graph shows the quantitation of Hp protein expressed as a percentage of actin levels. These data are derived from densitometry of autoradiographs and represent means ± SE of 3 separate animals.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

In recent years, genetic and molecular studies have greatly increased our knowledge of intestinal iron absorption and have led to the identification of a number of genes involved in this essential process. One of these is Hp, the gene defective in the sla mouse (35). In sla mice, iron is able to move from the intestinal lumen into the epithelial cells, but its subsequent passage across the basolateral membrane and into the circulation is defective (28, 29). This implicates Hp in the export of iron from enterocytes, but directed physiological studies are required to precisely define the role of Hp in intestinal iron transport. The rat is ideal for this type of analysis. To facilitate these studies, we have cloned the rat Hp gene and conducted a detailed investigation into the expression of Hp in the alimentary tract. This expression pattern has been compared with that of several other genes involved in iron transport.

Rat Hp was found to be 96% identical to mouse Hp, and, like its murine counterpart, is likely to be a membrane-bound protein. The molecule consists of a short predicted COOH-terminal cytoplasmic domain (completely conserved with the mouse protein), a putative transmembrane domain (differing from the mouse protein by a single, conservative amino acid change), and a large predicted extracellular domain. The extensive homology of the extracellular region with Cp (50% identity, 68% similarity) provides some clues to the function of Hp. Cp is a copper-containing serum protein with the capacity to oxidize ferrous iron to the ferric form, i.e., it has a ferroxidase activity (25). Many studies have shown that Cp plays an important role in iron release from cells and that its ferroxidase activity is required for iron efflux (26, 27, 30). The high homology between Hp and Cp, and particularly the conservation in Hp of all residues involved in copper binding and disulfide bond formation in Cp, suggests that Hp also is likely to exhibit ferroxidase activity. Like Cp, Hp is predicted to mediate iron efflux from cells, albeit in a more specialized capacity in the export of iron specifically from mature enterocytes.

The strong expression of Hp in the mature enterocytes of the rat duodenum is consistent with the protein playing a central role in iron absorption. Moderate expression was also observed in the colon with lower levels of expression in other tissues. The relatively high expression in the colon was surprising, as this part of the gastrointestinal tract does not normally participate in iron absorption (24). To investigate this further, we examined the expression of Hp along the length of the alimentary canal and compared this to the expression of other molecules involved in iron absorption. Hp was expressed at consistently high levels along the entire length of the small intestine and at lower levels throughout the colon. A markedly different pattern was seen with two other genes involved in intestinal iron transport. Both DMT1(IRE) and Ireg1 mRNA were expressed at high levels in the duodenum, but expression was much lower in the distal small intestine and colon. This expression pattern has been demonstrated previously for both DMT1 and Ireg1 protein (7, 10, 23). Thus molecules known (Hp, DMT1) or predicted (Ireg1) to play pivotal roles in iron absorption are highly expressed in the duodenum, but why one of them should also be highly expressed further down the intestine remains to be determined. It is possible that Hp is involved in an iron salvage pathway in the distal intestine, or that it performs some functions in addition to its iron transport role. The sla mice are not known to possess phenotypic features other than iron deficiency, arguing against a non-iron-related role for Hp in the distal intestine, but it is possible that these animals exhibit additional, minor phenotypic defects that are masked by the overt anemia.

How Hp facilitates iron release from enterocytes is not known. Although predicted to be membrane anchored, the presence of only a single transmembrane domain makes it unlikely that Hp alone could mediate the movement of iron across membranes. It is more likely to act in concert with an iron transporter. A precedent for this comes from studies in the yeast Saccharomyces cerevisiae, where a membrane-bound ferroxidase (FET3) works in conjunction with an iron transporter (FTR1) to transport iron into the cell (32). The only putative basolateral iron transporter that has been identified in the small intestine is Ireg1 (1, 10, 23), and thus it is the only candidate partner for Hp at present. However, the patterns of Hp and Ireg1 expression in the small intestine are quite different, and high levels of expression of both genes are only found in the duodenum. The intracellular location of the proteins also differs, with Hp being found in a supranuclear region and Ireg1 being previously localized to the basolateral membrane (1, 10, 23). This raises the possibility that Hp is involved in the intracellular trafficking of absorbed iron before the movement of iron across the basolateral membrane by Ireg1. A more detailed analysis of the distribution and cellular localization of Hp is necessary.

Although Ireg1 showed highest expression in the duodenum, it was also expressed in the spleen, liver, and placenta, indicating that it may also play a role in the release of iron from these tissues. Data consistent with this have recently been presented by Donovan et al. (10) in humans. Quantitatively, the major pathway of iron efflux in the body is the release of iron from phagocytosed erythrocytes by the reticuloendothelial system (8). The strong expression of Ireg1 in the spleen and liver, both tissues with large macrophage populations, suggests it may be involved in this process, and the localization of Ireg1 to Kupffer cells in the liver lends further support to this argument (10).

The other gene transcripts examined in this study were expressed throughout the gastrointestinal tract. DMT1(non-IRE) mRNA was found at uniformly low levels throughout the small intestine. Slightly higher expression of DMT1(non-IRE) was found in the duodenum, but whether this splice variant is involved in uptake of transferrin-bound iron from the circulation or in dietary iron uptake or both remains to be determined. The expression of HFE at low levels in all tissues tested suggests that this protein is not involved directly in iron absorption but rather acts to sense and/or regulate total body iron status. This information is then relayed back to the small intestine, where absorption is adjusted appropriately. An interaction between HFE and the TfR is considered crucial for the correct functioning of the HFE protein (12, 16), but the relevance of this interaction is unclear. Further studies are needed to determine how Hp and these other molecules act together in a coordinated fashion to allow iron to pass across the intestinal epithelium.


    ACKNOWLEDGEMENTS

D. M. Frazer was supported by a postgraduate scholarship from the Royal Children's Hospital Foundation, Brisbane, Australia. This work was supported in part by grants from the National Health and Medical Research Council of Australia (to G. J. Anderson) and by National Institute of Diabetes and Digestive and Kidney Diseases Grant R01 DK-57800-1 (to C. D. Vulpe, G. J. Anderson, and A. T. McKie).


    FOOTNOTES

Address for reprint requests and other correspondence: G. J. Anderson, Clinical Sciences Unit, Queensland Institute of Medical Research, Post Office Royal Brisbane Hospital, Brisbane, Queensland 4029, Australia (E-mail: gregA{at}qimr.edu.au).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received 24 July 2000; accepted in final form 21 May 2001.


    REFERENCES
TOP
ABSTRACT
INTRODUCTION
METHODS
RESULTS
DISCUSSION
REFERENCES

1.   Abboud, S, and Haile DJ. A novel mammalian iron-regulated protein involved in intracellular iron metabolism. J Biol Chem 275: 19906-19912, 2000[Abstract/Free Full Text].

2.   Anderson, GJ, Powell LW, and Halliday JW. The endocytosis of transferrin by rat intestinal epithelial cells. Gastroenterology 106: 414-422, 1994[ISI][Medline].

3.   Bannerman, RM, and Cooper RG. Sex-linked anemia: a hypochromic anemia of mice. Science 151: 581-582, 1966[Abstract/Free Full Text].

4.   Bannerman, RM, and Pinkerton PH. X-linked hypochromic anaemia of mice. Br J Haematol 13: 1000-1013, 1967[ISI][Medline].

5.   Basset, ML, Halliday JW, and Powell LW. Value of hepatic iron measurements in early hemochromatosis and determination of the critical iron level associated with fibrosis. Hepatology 6: 24-29, 1986[ISI][Medline].

6.   Byrnes, V, Ryan E, O'Keane C, and Crowe J. Immunohistochemistry of the Hfe protein in patients with hereditary hemochromatosis, iron deficiency anemia, and normal controls. Blood Cells Mol Dis 26: 2-8, 2000[ISI][Medline].

7.   Canonne-Hergaux, F, Gruenheid S, Ponka P, and Gros P. Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood 93: 4406-4417, 1999[Abstract/Free Full Text].

8.   Conrad, ME, and Barton JC. Factors affecting iron balance. Am J Hematol 10: 199-225, 1981[ISI][Medline].

9.   Crichton, RR, and Charloteaux-Wauters M. Iron storage and transport. Eur J Biochem 164: 485-506, 1987[ISI][Medline].

10.   Donovan, A, Brownlie A, Zhou Y, Shepard J, Pratt SJ, Moynihan J, Paw BH, Drejer A, Barut B, Zapata A, Law TC, Brugnara C, Lux SE, Pinkus GS, Pinkus JL, Kingsley PD, Palis J, Fleming MD, Andrews NC, and Zon LI. Positional cloning of zebrafish ferroportin1 identifies a conserved vertebrate iron exporter. Nature 403: 776-781, 2000[Medline].

11.   Feder, JN, Gnirke A, Thomas W, Tsuchihashi Z, Ruddy DA, Basava A, Dormishain F, Domingo R, Jr, Ellis MC, Fullan A, Hinton LM, Jones NL, Kimmel BE, Kronmal GS, Lauer P, Lee VK, Loeb DB, Mapa FA, McClelland E, Meyer NC, Mintier GA, Moeller N, Moore T, Morikang E, Prass CE, Quintana L, Starnes SM, Schatzman RC, Brunke KJ, Drayna DT, Risch NJ, Bacon BR, and Wolff RK. A novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis. Nat Genet 13: 399-408, 1996[ISI][Medline].

12.   Feder, JN, Penny DM, Irrinki A, Lee VK, Lebrón JA, Watson N, Tsuchihashi Z, Sigal E, Bjorkman PJ, and Schatzman RC. The hemochromatosis gene product complexes with the transferrin receptor and lowers its affinity for ligand binding. Proc Natl Acad Sci USA 95: 1472-1477, 1998[Abstract/Free Full Text].

13.   Fleming, MD, Trenor CC, III, Su MA, Foernzler D, Beier DR, Dietrich WF, and Andrews NC. Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat Genet 16: 383-386, 1997[ISI][Medline].

14.   Fleming, RE, and Gitlin JD. Primary structure of rat ceruloplasmin and analysis of tissue-specific gene expression during development. J Biol Chem 265: 7701-7707, 1990[Abstract/Free Full Text].

15.   Fleming, RE, Migas MC, Zhou XY, Jiang J, Britton RS, Brunt EM, Tomatsu S, Waheed A, Bacon BR, and Sly WS. Mechanism of increased iron absorption in murine model of hereditary hemochromatosis: increased duodenal expression of the iron transporter DMT1. Proc Natl Acad Sci USA 96: 3143-3148, 1999[Abstract/Free Full Text].

16.   Gross, CN, Irrinki A, Feder JN, and Enns CA. Co-trafficking of HFE, a nonclassical major histocompatibility complex class I protein, with the transferrin receptor implies a role in intracellular iron regulation. J Biol Chem 273: 22068-22074, 1998[Abstract/Free Full Text].

17.   Gunshin, H, Mackenzie B, Berger UV, Gunshin Y, Romero MF, Boron WF, Nussberger S, Gollan JL, and Hediger MA. Cloning and characterization of a mammalian proton-coupled metal-ion transporter. Nature 388: 482-488, 1997[Medline].

18.   Kühn, LC. Iron and gene expression: molecular mechanisms regulating cellular iron homeostasis. Nutr Rev 56: S11-S19, 1998.

19.   Lee, PL, Gelbart T, West C, Halloran C, and Beutler E. The human Nramp2 gene: characterization of the gene structure, alternative splicing, promotor region and polymorphisms. Blood Cells Mol Dis 24: 199-215, 1998[ISI][Medline].

20.   Logan, JI, Harveyson KB, Wisdom GB, Hughes AE, and Archbold GPR Hereditary caeruloplasmin deficiency, dementia and diabetes mellitus. QJM 87: 663-670, 1994[Abstract/Free Full Text].

21.   Lombard, M, Chua E, and O'Toole P. Regulation of intestinal non-haem iron absorption. Gut 40: 435-439, 1997[Free Full Text].

22.   McCance, RA, and Widdowson EM. Absorption and excretion of iron. Lancet ii: 680-684, 1937.

23.   McKie, AT, Marciani P, Rolfs A, Brennan K, Wehr K, Barrow D, Miret S, Bomford A, Peters TJ, Farzaneh F, Hediger MA, Hentze MW, and Simpson RJ. A novel duodenal iron-regulated transporter, IREG1, implicated in the basolateral transfer of iron to the circulation. Mol Cell 5: 299-309, 2000[ISI][Medline].

24.   Murray, MJ, Delaney JP, and Stein N. Use of isolated subcutaneous intestinal loops for direct study of intestinal absorption of radioisotopes in dogs. Am J Dig Dis 9: 684-689, 1964.

25.   Osaki, S. Kinetic studies of ferrous ion oxidation with crystalline human ferroxidase (ceruloplasmin). J Biol Chem 241: 5053-5059, 1966[Abstract/Free Full Text].

26.   Osaki, S, Johnson DA, and Frieden E. The possible significance of the ferrous oxidase activity of ceruloplasmin in normal human serum. J Biol Chem 241: 2746-2751, 1996[Abstract/Free Full Text].

27.   Osaki, S, Johnson DA, and Frieden E. The mobilization of iron from the perfused mammalian liver by a serum copper enzyme, ferroxidase I. J Biol Chem 246: 3018-3023, 1971[Abstract/Free Full Text].

28.   Pinkerton, PH. Histological evidence of disordered iron transport in the X-linked hypochromic anaemia of mice. J Pathol Bacteriol 95: 155-165, 1968[ISI][Medline].

29.   Pinkerton, PH, and Bannerman RM. Hereditary defect in iron absorption in mice. Nature 216: 482-483, 1967[Medline].

30.   Roeser, HP, Lee GR, Nacht S, and Cartwright GE. The role of ceruloplasmin in iron metabolism. J Clin Invest 49: 2408-2417, 1970.

31.   Sambrook, J, Fritsch EF, and Maniatis T. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.

32.   Stearman, R, Yuan DS, Yamaguchi-Iwai Y, Klausner RD, and Dancis A. A permease-oxidase complex involved in high-affinity iron uptake in yeast. Science 271: 1552-1557, 1996[Abstract].

33.   Trinder, D, Oates PS, Thomas C, Sadlier J, and Morgan EH. Localisation of divalent metal transporter 1 (DMT1) to the microvillus membrane of rat duodenal enterocytes in iron deficiency, but to hepatocytes in iron overload. Gut 46: 270-276, 2000[Abstract/Free Full Text].

34.   Valberg, LS, Taylor KB, Witts LJ, and Richards WCD The effect of iron-deficiency on the stomach of the rat. Br J Nutr 15: 473-480, 1961[ISI][Medline].

35.   Vulpe, CD, Kuo Y, Murphy TL, Cowley L, Askwith C, Libina N, Gitschier J, and Anderson GJ. Hephaestin, a ceruloplasmin homologue implicated in intestinal iron transport, is defective in the sla mouse. Nat Genet 21: 195-199, 1999[ISI][Medline].


Am J Physiol Gastrointest Liver Physiol 281(4):G931-G939
0193-1857/01 $5.00 Copyright © 2001 the American Physiological Society



This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K.-y. Yeh, M. Yeh, L. Mims, and J. Glass
Iron feeding induces ferroportin 1 and hephaestin migration and interaction in rat duodenal epithelium
Am J Physiol Gastrointest Liver Physiol, January 1, 2009; 296(1): G55 - G65.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. D. San Martin, C. Garri, F. Pizarro, T. Walter, E. C. Theil, and M. T. Nunez
Caco-2 Intestinal Epithelial Cells Absorb Soybean Ferritin by {micro}2 (AP2)-Dependent Endocytosis
J. Nutr., April 1, 2008; 138(4): 659 - 666.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. Boult, K. Roberts, M. J. Brookes, S. Hughes, J. P. Bury, S. S. Cross, G. J. Anderson, R. Spychal, T. Iqbal, and C. Tselepis
Overexpression of Cellular Iron Import Proteins Is Associated with Malignant Progression of Esophageal Adenocarcinoma
Clin. Cancer Res., January 15, 2008; 14(2): 379 - 387.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
D. M. Frazer, S. J. Wilkins, and G. J. Anderson
Elevated iron absorption in the neonatal rat reflects high expression of iron transport genes in the distal alimentary tract
Am J Physiol Gastrointest Liver Physiol, September 1, 2007; 293(3): G525 - G531.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. A. Markel, P. R. Crisostomo, M. Wang, C. M. Herring, K. K. Meldrum, K. D. Lillemoe, and D. R. Meldrum
The struggle for iron: gastrointestinal microbes modulate the host immune response during infection
J. Leukoc. Biol., February 1, 2007; 81(2): 393 - 400.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
M J Brookes, S Hughes, F E Turner, G Reynolds, N Sharma, T Ismail, G Berx, A T McKie, N Hotchin, G J Anderson, et al.
Modulation of iron transport proteins in human colorectal carcinogenesis
Gut, October 1, 2006; 55(10): 1449 - 1460.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
C. Chicault, B. Toutain, A. Monnier, M. Aubry, P. Fergelot, A. L. Treut, M.-D. Galibert, and J. Mosser
Iron-related transcriptomic variations in CaCo-2 cells, an in vitro model of intestinal absorptive cells
Physiol Genomics, September 14, 2006; 26(1): 55 - 67.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
R. E. Fleming and R. S. Britton
Iron Imports. VI. HFE and regulation of intestinal iron absorption
Am J Physiol Gastrointest Liver Physiol, April 1, 2006; 290(4): G590 - G594.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
K N Millard, D M Frazer, S J Wilkins, and G J Anderson
Changes in the expression of intestinal iron transport and hepatic regulatory molecules explain the enhanced iron absorption associated with pregnancy in the rat
Gut, May 1, 2004; 53(5): 655 - 660.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
K.-y. Yeh, M. Yeh, and J. Glass
Hepcidin regulation of ferroportin 1 expression in the liver and intestine of the rat
Am J Physiol Gastrointest Liver Physiol, March 1, 2004; 286(3): G385 - G394.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
Y M Kuo, T Su, H Chen, Z Attieh, B A Syed, A T McKie, G J Anderson, J Gitschier, and C D Vulpe
Mislocalisation of hephaestin, a multicopper ferroxidase involved in basolateral intestinal iron transport, in the sex linked anaemia mouse
Gut, February 1, 2004; 53(2): 201 - 206.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
C. Thomas and P. S. Oates
Copper deficiency increases iron absorption in the rat
Am J Physiol Gastrointest Liver Physiol, November 1, 2003; 285(5): G789 - G795.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Chen, T. Su, Z. K. Attieh, T. C. Fox, A. T. McKie, G. J. Anderson, and C. D. Vulpe
Systemic regulation of Hephaestin and Ireg1 revealed in studies of genetic and nutritional iron deficiency
Blood, September 1, 2003; 102(5): 1893 - 1899.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
J. C. Fleet, L. Wang, O. Vitek, B. A. Craig, and H. J. Edenberg
Gene expression profiling of Caco-2 BBe cells suggests a role for specific signaling pathways during intestinal differentiation
Physiol Genomics, March 18, 2003; 13(1): 57 - 68.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
D M Frazer, S J Wilkins, E M Becker, T L Murphy, C D Vulpe, A T McKie, and G J Anderson
A rapid decrease in the expression of DMT1 and Dcytb but not Ireg1 or hephaestin explains the mucosal block phenomenon of iron absorption
Gut, March 1, 2003; 52(3): 340 - 346.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
B. N. Patel, R. J. Dunn, S. Y. Jeong, Q. Zhu, J.-P. Julien, and S. David
Ceruloplasmin Regulates Iron Levels in the CNS and Prevents Free Radical Injury
J. Neurosci., August 1, 2002; 22(15): 6578 - 6586.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
C. Thomas and P. S. Oates
IEC-6 Cells Are an Appropriate Model of Intestinal Iron Absorption in Rats
J. Nutr., April 1, 2002; 132(4): 680 - 687.
[Abstract] [Full Text] [PDF]


Home page