AJP - GI Fuel your research with LabChart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am J Physiol Gastrointest Liver Physiol 286: G528-G537, 2004. First published December 4, 2003; doi:10.1152/ajpgi.00189.2003
0193-1857/04 $5.00
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
286/4/G528    most recent
00189.2003v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Alzoghaibi, M. A.
Right arrow Articles by Graham, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Alzoghaibi, M. A.
Right arrow Articles by Graham, M. F.

INFLAMMATION/IMMUNITY/MEDIATORS

Linoleic acid induces interleukin-8 production by Crohn's human intestinal smooth muscle cells via arachidonic acid metabolites

Mohammad A. Alzoghaibi,1 Scott W. Walsh,1,2 Amy Willey,2 Dorne R. Yager,3 Alpha A. Fowler, III,4 and Martin F. Graham5

1Departments of Physiology, 2Obstetrics and Gynecology, 3Surgery, 4Internal Medicine, and 5Pediatrics, Virginia Commonwealth University, Richmond, Virginia 23298

Submitted 25 April 2003 ; accepted in final form 19 November 2003


    ABSTRACT
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Previously we reported that linoleic acid (LA), but not oleic acid, caused a marked increase in the secretion of IL-8 by Crohn's human intestinal smooth muscle (HISM) cells. Antioxidants inhibited this response, implicating a role for oxidative stress and NF-{kappa}B, a transcription factor for IL-8 that is activated by oxidative stress. In this study, we examined two mechanisms whereby LA, the dietary precursor for arachidonic acid (AA), could increase the production of IL-8 via activation of AA pathways: 1) by generation of reactive oxygen species by the AA-pathway enzymes to activate NF-{kappa}B or 2) by AA metabolites. Normal and Crohn's HISM cells were exposed to LA, oxidizing solution (Ox), or oxidizing solution enriched with LA (OxLA). Exposure of cells to Ox or OxLA induced oxidative stress as determined by thiobarbituric acid reactive substances. In normal cells, Ox but not LA activated NF-{kappa}B as determined by transfection experiments and Western blot. In Crohn's cells, NF-{kappa}B was spontaneously activated and was not further activated by Ox or LA. In contrast, TNF-{alpha} markedly increased activation of NF-{kappa}B in both normal and Crohn's cells. These results indicated that LA did not increase IL-8 by activating NF-{kappa}B, so we evaluated the second mechanism of an effect of AA metabolites. In normal cells, OxLA, but not LA, markedly stimulated IL-8, whereas in Crohn's cells, both OxLA and LA stimulated IL-8. OxLA, also stimulated production of AA metabolites leukotriene B4 (LTB4), PGE2, and thromboxane B2 (TXB2) by normal and Crohn's cells. To determine whether AA metabolites mediated the IL-8 response, cells were treated with OxLA plus indomethacin (Indo), a cyclooxygenase inhibitor, and nordihydroguaiaretic acid (NDGA), a lipoxygenase inhibitor. Both Indo and NDGA blocked the IL-8 response to OxLA. To determine more specifically a role for AA metabolites, AA was used. Similar to OxLA, OxAA stimulated production of IL-8 and AA metabolites. Pinane thromboxane, a selective thromboxane synthase inhibitor and receptor blocker, inhibited OxAA stimulation of TXB2 and IL-8 in a dose-response manner. MK886, a selective 5-lipoxygenase inhibitor, inhibited OxAA stimulation of LTB4 and IL-8 also in a dose-response manner. Analysis of specific gene products by RT-PCR demonstrated that HISM cells expressed receptors for both thromboxane and LTB4. We conclude that AA metabolites mediated the IL-8 response to LA in HISM cells. Both cyclooxygenase and lipoxygenase pathways were involved. LA did not increase IL-8 by activating NF-{kappa}B, but NF-{kappa}B appeared to be involved, because LA increased IL-8 only in situations where NF-{kappa}B was activated, either spontaneously in Crohn's cells or by Ox in normal cells. We speculate that AA metabolites increased IL-8 production by enhancing NF-{kappa}B-dependent transcription of IL-8.

NF-{kappa}B; leukotriene B4; prostaglandin E2; thromboxane


CHRONIC INFLAMMATORY DISEASES are a major health problem throughout the world. Inflammatory bowel disease, such as Crohn's disease and ulcerative colitis, are debilitating diseases of the bowel characterized by chronic inflammation. The etiologies of Crohn's disease and ulcerative colitis are still unknown. The main pathological feature of inflammatory bowel disease is an infiltration of neutrophils and mononuclear cells into the affected part of the intestine (16, 38, 42, 51).

Leukocytes infiltrate into tissue in response to chemotactic signals produced by the tissue. The most potent chemotactic signaling molecules are chemokines (23). Chemokines play a major role in inflammation. The {alpha}-chemokine IL-8 is chemotactic for neutrophils (23). IL-8 may play an important role in Crohn's disease. Several studies indicate that mucosa contains significantly more IL-8 in patients with active inflammatory bowel disease than in normal control subjects (5, 9, 16, 25, 28).

Recently, we reported (31) that smooth muscle cells isolated from the stricture of a Crohn's patient spontaneously secreted higher quantities of IL-8 than normal cells. In another study, we observed a ninefold increase in IL-8 secretion when smooth muscle cells isolated from the stricture of Crohn's patients were exposed to linoleic acid (LA) (1). This effect was specific for LA and did not occur with oleic acid and was also blocked by antioxidants, implicating a role for oxidative stress. Given that smooth muscle cells comprise the mass of the stricture in Crohn's patients, IL-8 production by these cells could play an important role in inflammation by recruiting neutrophils to the stricture.

Because LA is a common dietary fatty acid, understanding the mechanism responsible for the LA-induced effect on IL-8 could have clinical significance. LA is the precursor for arachidonic acid (AA) and its metabolites, so the effect of LA to stimulate IL-8 could be by activation of the AA pathways. The AA metabolites are synthesized via two major enzymatic pathways: 1) cyclooxygenase, leading to prostaglandins and thromboxanes, and 2) 5-lipoxygenase, leading to leukotrienes. The cyclooxygenase and lipoxygenase enzymes generate reactive oxygen species (ROS) when activated (19).

IL-8 is regulated by NF-{kappa}B, a transcription factor that activates genes involved in inflammatory and immune responses (3, 4). NF-{kappa}B is present in the cytosol as two subunits, p65 and p50, bound to inhibitory-{kappa}B (I{kappa}B). On activation, the subunits dissociate from I{kappa}B and enter the nucleus where they bind to NF-{kappa}B binding sites to enhance expression of inflammatory genes. Oxidants are effective inducers of NF-{kappa}B activation (4, 43, 44, 50), whereas AA metabolites have been shown to enhance NF-{kappa}B-dependent transcription (2, 17, 37). We hypothesized that LA might increase IL-8 production by one of two mechanisms: 1) by activating AA pathway enzymes to generate ROS to activate NF-{kappa}B or 2) by AA pathway metabolites (Fig. 1).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 1. Two proposed mechanisms whereby linoleic acid (LA) could increase the production of IL-8 via activation of the arachidonic acid (AA) pathways: 1) by generation of reactive oxygen species (ROS) by the cyclooxygenase and lipoxygenase enzymes to activate NF-{kappa}B to increase IL-8 production; or 2) by AA metabolites to increase IL-8 production. LTs, leukotrienes; TX, thromboxane.

 


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Human Subjects

Tissues for isolation of human intestinal smooth muscle cells from normal and Crohn's patients were obtained from Medical College of Virginia Hospitals of Virginia Commonwealth University Health System (Richmond, VA). This study was approved by the Virginia Commonwealth University Office of Research Subjects Protection. Normal jejunal tissue was obtained from patients undergoing gastric bypass operations. Tissue from the jejunum was used preferentially because it is relatively free of gastrointestinal microorganisms. Crohn's tissue was taken from the specimens of strictured bowel (ileum or colon) that were resected for surgical reasons and were pathological specimens.

Human Intestinal Smooth Muscle Cells

Isolation of human intestinal smooth muscle cells. Human intestinal smooth muscle (HISM) cells were isolated as previously described (13). When confluent after 3–4 wk in culture, the smooth muscle cells were released from the plates by trypsinization (0.25% trypsin-EDTA) and frozen. To freeze the cells, 200 µl of dimethylsulfoxide (Sigma, St. Louis, MO) were added to 1.0 ml of cell suspension (1 x 105 cells) to keep cell integrity during freezing. The cells were transferred to 1.5-ml cryotubes in 1-ml aliquots and stored in liquid nitrogen.

Culture conditions. To prepare the cells for each experiment, one cryotube was removed from liquid nitrogen and thawed in a 37°C water bath. One milliliter of the cell suspension (1 x 105 cells) was added into a 100-mm culture dish containing 10 ml DMEM supplemented with 20% FBS. Cells were allowed to grow to confluence for 3–4 wk. Meticulous attention was paid to ensure true smooth muscle cell phenotype for each batch of cells by screening for a panel of smooth muscle cytoskeletal proteins by immunoblot ({alpha}-smooth muscle isoactin, tropomyosin, calponin, h-caldesmon, and metavinculin). Cells were used within three to six passages of isolation to preclude cell dedifferentiation from confounding the results. Stability of phenotype of the cells after passage was indicated not only by screening for smooth muscle cytoskeletal proteins but also by maintenance of spontaneous activation of NF-{kappa}B in Crohn's cells and retention of their remarkable ability to produce IL-8 in response to LA.

NF-{kappa}B Activation

Transient transfection and dual luciferase reporter assay system. To examine the activation of NF-{kappa}B in HISM cells, transient transfection studies were done with a pGL3 luciferase reporter construct containing the NF-{kappa}B binding region of the human IL-8 promoter upstream from the firefly luciferase gene. Transfection of this reporter construct into the cells allowed determination as to whether a particular treatment activated NF-{kappa}B, because activation of the NF-{kappa}B binding site of the reporter would result in expression of firefly luciferase with an increase in luminescence. Development of this reporter construct, designated BF2, was previously described (12). The identity of the NF-{kappa}B binding site on BF2 was confirmed using a BF2 mutant, which was created by site-directed mutagenesis, to introduce a four-point transversion mutation into the native NF-{kappa}B site. For validation, negative controls received plasmid bearing the luciferase gene but lacking an upstream promoter (pGL3-basic), whereas positive controls received a plasmid (pGL3-SV40) bearing the strong viral promoter SV40 linked to (luc+). pRL-TK, which contains a weak herpes simplex virus thymidine kinase promoter region upstream from Renilla luciferase gene, was cotransfected as a control for the transfection procedure. pRL-TK produced a low level of luminescence. Luminescence produced by BF2 was indexed to luminescence produced by pRL-TK.

HISM cells were seeded into 24-well cell culture plates (Costar, Corning, NY) at a density of 40,000 cells/well. Cells were grown for 72 h in DMEM supplemented with 10% FBS. The cells reached a state of 50% confluence at the end of the incubation period. The BF2 construct and pRL-TK plasmid were transfected into the cells using Effectene (Qiagen, Valencia, CA) for 6 h. Cells were washed with phosphate buffered saline and then incubated in DMEM with the following treatments for 16 h according to the protocol supplied by the manufacturer for the transfection reagents: 1) pGL-basic (plasmid control); 2) BF2 mutant (control for specificity of the BF2 construct); 3) BF2 construct; 4) BF2 + LA (20–45 µM); 5) BF2 + Ox; and 6) BF2 + TNF-{alpha} (1 ng/ml). Each treatment was done in triplicate. The luminescence output of lysed cells was quantified by using a commercially available dual luciferase reporter assay (Promega, Madison, WI). Firefly and Renilla luciferases were measured sequentially for each sample. Luminescence was recorded on a luminometer (Lumat LB9501, Berthold). Results were expressed as relative light units (RLU).

NF-{kappa}B and I{kappa}B Western blot analysis. Normal HISM cells and HISM cells from Crohn's patients were grown to confluence in DMEM and 10% FBS in 100-mm-diameter culture dishes (Nunc, Naperville, IL). When the cells reached 100% confluence, they were placed in DMEM without serum for 24 h so they would become quiescent before starting treatments. Cells were treated with LA (90 µM) and incubated for 10, 30, and 60 min and 4 and 24 h. Control cells were incubated with DMEM. After treatment, cells were placed on ice, washed twice with cold phosphate buffered saline, and then resuspended in lysis buffer (10 ml 1 M HEPES per liter, 0.75 g/l KCl, 0.037 g/l EDTA, 0.046 g/l EGTA, 0.084 g/l NaF). Cells were scraped into 1.5-ml tubes and vortexed at maximum speed for 10 s. The cell homogenate was centrifuged for 5 min at 6,000 g at 4°C. The supernatant was removed and stored at -70°C as cytoplasmic extracts. The nuclear pellet was resuspended in 50 µl of cold buffer (20 ml 1 M HEPES per liter, 22.77 g/l NaCl, 0.37 g/l EDTA, 0.468 g/l EGTA, 0.084 g/l NaF) and vortexed for 10 s. The nuclear extracts were centrifuged at 50,000 g for 1 h at 4°C. The supernatant was removed and stored at -70°C as nuclear extracts. Total protein content of the supernatant was determined by Coomassie blue dye binding method. Twenty-five micrograms of total cellular protein were fractionated in a denaturing 10% SDS-PAGE at 25 mA. The nitrocellulose membrane was incubated with polyclonal antibody directed against the p65 subunit of NF-{kappa}B (1:1,000, Santa Cruz Biotechnology, Santa Cruz, CA) for 2–3 h with rotational shaking at room temperature. I{kappa}B was also analyzed in the cytosol fraction using a polyclonal antibody directed against I{kappa}B{alpha} (1:100, Santa Cruz Biotechnology). The blots were washed three times for 15 min, and proteins were detected using an Amersham enhanced chemiluminescence system with Hyperfilm MP (Amersham, Arlington Heights, IL).

LA and AA Experiments

For the LA experiments, HISM cells were seeded in 100-mm culture dishes and grown to confluence in DMEM with 10% FBS. Cells were then placed into DMEM without serum for 24 h to allow them to become quiescent before beginning any experimental treatments. Cells were incubated for 24 h with the following treatments: 1) DMEM; 2) oxidizing solution (Ox; containing hypoxanthine, 0.9 mM plus xanthine oxidase, 0.004 U/ml + ferrous sulfate, 50 µM); 3) LA (90 µM); 4) Ox enriched with LA (OxLA); 5) OxLA plus indomethacin (Indo; 50 µM), a cyclooxygenase inhibitor; or 6) OxLA plus nordihydroguaiaretic acid (NDGA; 10 µM), a lipoxygenase inhibitor. Data were expressed per milligram of protein.

For the AA experiments, HISM cells were seeded in 24-well culture plates and grown to confluence in DMEM with 10% FBS. Cells were then placed into DMEM without serum for 24 h. Cells were incubated for 24 h with 1) DMEM; 2) AA (5 µM); 3) Ox enriched with AA (OxAA); 4) OxAA plus MK886 (0.25–1.0 µM), a selective 5-lipoxygenase inhibitor; or 5) OxAA plus pinane thromboxane A2 (PTA2; 0.3–5 µM), a thromboxane synthase inhibitor and thromboxane receptor blocker. Data were expressed per milliliter.

Indomethacin and NDGA were purchased from Sigma. LA and PTA2 were purchased from Cayman Chemical. MK886 was purchased from Calbiochem (San Diego, CA). LA, Indo, NDGA, PTA2, and MK886 were initially diluted in 100% ethanol and then diluted to final concentration in DMEM. Final concentrations of ethanol were <0.5%. Vehicle controls were run with ethanol to ensure these small amounts of ethanol did not affect cell function.

Cells and media were collected from the culture dishes after 24 h of exposure to the experimental treatments. Cells were rinsed with phosphate buffered saline, harvested, centrifuged for 5 min at 1,000 g, suspended in 1 ml of double distilled water, and stored at -20°C. HISM cells were homogenized for analysis of thiobarbituric acid reactive substances (TBARS) and protein.

Leukotriene B4 and Thromboxane Receptor Analysis

RT-PCR was used to assess gene expression of receptors for leukotriene B4 (LTB4) and thromboxane in HISM cells. Primers were designed to yield amplicons of ~200 bp using SeqWeb version 2.0.2. Gene-specific sense and antisense primer pairs were designed from the nucleotide sequence for Homo sapiens LTB4 receptor (LTB-R) (GenBank accession no. BC004545 [GenBank] ) and for human thromboxane A2 (TxA2) receptor (TX-R; GenBank accession no. U27325 [GenBank] ). Gene specificity was determined by entering the sequences of the sense and antisense primers and the PCR products into the BLAST program of the National Center for Biotechnology Information (Washington, DC). The gene-specific pairs used were LTB-R (sense primer 5'-281attggcatcagcttccaac299-3' and antisense primer 5'-478ttctgcatccttttcaggatac457-3') and TX-R (sense primer 5'-331ctggtcctcaccgacttcct350-3' and antisense primer 5'-525gatacccaggtagcgctctg506-3'). Primers were synthesized by Sigma-Genosys (The Woodlands, TX). The amplicons generated by RT-PCR were verified for specificity by sequencing by the Nucleic Acids Research Facility of Virginia Commonwealth University Medical Center.

Total cellular RNA was extracted from confluent HISM cells using an RNeasy Mini kit according to the procedure provided by the manufacturer (Qiagen). The RNA fraction was collected and used to synthesize cDNA for RT-PCR of gene expression. First-strand cDNA synthesis was performed using 10 µl of RNA purified with an RNeasy minicolumn, 3 µg/1 µl of random primers (mostly hexamers) in 28 µl water at 65°C for 5 min. To this reaction was added 10 µl of 10x reaction buffer (200 mM Tris·HCl, pH 8.4, 500 mM KCl), 5 µl 10 mM dNTP mix composed of 10 mM each of deoxyadenosine triphosphate, deoxythymidine triphosphate, deoxyguanidine triphosphate, and deoxycytidine triphosphate, and 1 µl SuperScript II RT (200 U). Reagents were purchased from Invitrogen (Carlsbad, CA). One microliter of RNasin ribonuclease inhibitor (40 units, Promega) was also added to inhibit RNases. This mixture was incubated at 37°C for 1 h.

First-strand cDNA was used as a template for the PCR amplification of LTB-R or TX-R. The reaction mixture consisted of 10x PCR buffer (5 µl), 10 mM dNTP mixture (1 µl), 50 mM MgCl2 (1.5 µl), 10 µM each of sense and antisense primer mix (1 µl), first-strand cDNA (2 µl), 1.0 unit platinium Taq DNA polymerase (0.2 µl), and water (39 µl). PCR amplifications were carried out using a PTC-200 DNA Engine (MJ Research, Watertown, MA) with the following conditions: denaturation and enzyme activation at 94°C for 5 min, then amplification using a "touchdown" protocol with denaturing at 94°C for 30 s, and annealing from 60 to 52°C in half-degree increment cycles for 30 s each with extension at 72°C for 30 s. Multiple cycles were performed at each annealing temperature (the first 8 cycles were repeated once, the last 8 were repeated twice for a total of 40 cycles). Final extension was at 72°C for 5 min and maintenance of the reaction was at 4°C after cycling. Products were analyzed by 1.5% agarose gel electrophoresis and visualized by ethidium bromide staining using molecular weight standards.

Assays

IL-8 concentrations were determined by enzyme immunoassay (EIA) using commercially available reagents: anti-human IL-8 monoclonal capture antibody, biotinylated anti-human IL-8 detection antibody, and recombinant human IL-8 (R&D Systems, Minneapolis, MN). LTB4, PGE2, and TXB2, the stable metabolite of TxA2, were analyzed by commercially available EIA kits (R&D Systems). Oxidative stress was assessed by measurement of TBARS, which primarily reflects malondialdehyde, a breakdown product of lipid peroxides (18). HISM cell viability under experimental conditions was determined by the thiazolyl blue tetrazolium bromide (MTT) cell growth and viability assay as previously described (29). The amount of protein of HISM cell homogenates was measured by Coomassie plus blue dye binding method (Pierce, Rockford, IL).

Statistical Analysis

Data were analyzed by one-way analysis of variance with Fisher's protected least significant difference post hoc test. A probability level of P < 0.05 was considered to be statistically significant. Data are presented as means ± SE. A statistical computer software program was used for analysis (StatView, Abacus Concepts, Berkeley, CA).


    RESULTS
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
NF-{kappa}B Activation

To test the first hypothesis that LA induces IL-8 production by activating NF-{kappa}B, transient transfection experiments were conducted with an NF-{kappa}B reporter construct, BF2. Positive and negative controls were used to validate the transfection protocol. Both normal and Crohn's HISM cells readily took up the reporter construct (BF2) during the 6-h transfection (Fig. 2). As expected, neither normal nor Crohn's HISM cells transfected with pGL3-Basic (plasmid negative control) showed any appreciable firefly luciferase activity (RLU). Unstimulated Crohn's cells exhibited significant spontaneous NF-{kappa}B activation compared with normal cells as evidenced by significantly higher RLU by cells transfected with BF2. Treatment with LA (BF2 + LA) did not increase NF-{kappa}B activation in either normal or Crohn's HISM cells over spontaneous activity. Subjecting cells to oxidative stress (BF2 + Ox) significantly increased NF-{kappa}B activation in normal cells to the same extent as endogenous activity in Crohn's cells. In contrast, subjecting Crohn's cells to oxidative stress did not further increase NF-{kappa}B activity over unstimulated cells. TNF-{alpha} significantly increased NF-{kappa}B activation in both normal and Crohn's cells compared with control. Cells transfected with the BF2 mutant showed no appreciable firefly luciferase activity, indicating specificity of the BF2 reporter construct for NF-{kappa}B activation.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 2. Normal and Crohn's human intestinal smooth muscle (HISM) cell NF-{kappa}B activation in the presence of LA, oxidizing solution (Ox), or TNF-{alpha}. A reporter construct, BF2, with the NF-{kappa}B binding site linked to firefly luciferase gene was transfected into normal and Crohn's cells to assess NF-{kappa}B activation. After transfection, cells were incubated in DMEM for 16 h with the following treatments: 1) pGL-basic (plasmid control); 2) BF2 mutant (control for specificity of the BF2 construct); 3) BF2 construct; 4) BF2 + LA (20–45 µM); 5) BF2 + Ox; and 6) BF2 + TNF-{alpha} (1 ng/ml). Cells transfected with the pGL-basic plasmid or the BF2 mutant showed no appreciable firefly luciferase activity [relative light units (RLU)]. Unstimulated Crohn's HISM cells transfected with the BF2 construct showed significant spontaneous activation of NF-{kappa}B compared with normal unstimulated cells indicating the presence of oxidative stress. Treatment with LA did not increase NF-{kappa}B activation over the unstimulated state in either normal or Crohn's cells. Subjecting cells to exogenous oxidative stress (Ox) significantly increased the activity of NF-{kappa}B in normal cells but did not activate NF-{kappa}B further over spontaneous activity in Crohn's cells. TNF-{alpha} induced a threefold increase in activation of NF-{kappa}B in Crohn's cells and a 14-fold increase in normal cells compared with unstimulated cells. [Data represent means ± SE; asignificantly higher than normal BF2 (P < 0.05); bsignificantly higher than a (P < 0.05, n = 6)].

 

Western blot analysis was used to confirm the results of the transfection experiments. As shown in Fig. 3, the intensity of the bands of the p65 subunit of NF-{kappa}B was much stronger in the cytosolic than in the nuclear extracts obtained from normal cells, whereas cytosolic and nuclear extracts obtained from Crohn's cells showed the same level of intensity, indicating activation and translocation of NF-{kappa}B from the cytosol to the nucleus in the Crohn's cells. Treatment with LA did not increase the nuclear fraction of NF-{kappa}B in either normal or Crohn's cells. Intensities of the bands for I{kappa}B were detectable in normal HISM cells but barely detectable in Crohn's HISM cells. LA had no effect on the intensity of the I{kappa}B bands in either normal or Crohn's cells, indicating that LA did not cause I{kappa}B degradation (Fig. 4).



View larger version (42K):
[in this window]
[in a new window]
 
Fig. 3. Effect of LA on the translocation of NF-{kappa}B from the cytosol to the nucleus. Normal and Crohn's HISM cells were cultured in 100-mm dishes. Cells were exposed to either medium alone (control lanes) or to medium containing LA (90 µM) for 10, 30, or 60 min or 4 or 24 h. Cells were harvested for preparation of cytosolic (C) and nuclear (N) extracts. Western blot analysis was performed using a polyclonal antibody against the p65 subunit of NF-{kappa}B at a titer of 1:1,000. NF-{kappa}B was present primarily in the cytosol in normal cells (A), indicating that it was not activated, but in Crohn's cells (B), it was present in the nucleus, indicating spontaneous activation. Density for NF-{kappa}B in the nucleus was significantly greater for Crohn's cells than for normal cells (P < 0.01). Treatment with LA did not cause translocation of NF-{kappa}B from the cytosol to the nucleus in either normal or Crohn's cells (n = 5).

 


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 4. Effect of LA on the levels of the cytosolic NF-{kappa}B inhibitory binding protein I{kappa}B in normal (A) and Crohn's (B) HISM cells. Cells were cultured as for Fig. 3. A polyclonal antibody against I{kappa}B{alpha} was used at a titer of 1:100. There was no indication that LA induced degradation of I{kappa}B in either normal or Crohn's cells, further confirming that LA does not activate NF-{kappa}B (n = 5).

 

Verification of Oxidative Stress

To verify that Ox and OxLA were inducing oxidative stress, the cellular levels of TBARS were analyzed. TBARS primarily reflect malondialdehyde, a breakdown product of lipid peroxides (18), and are commonly used as a measure of oxidative stress. We have previously shown that TBARS highly correlate with 8-isoprostane for media samples and so accurately reflect lipid peroxidation (49). TBARS were significantly higher in normal and Crohn's cells exposed to either Ox or OxLA compared with DMEM control or LA (Fig. 5). Crohn's OxLA was significantly higher than normal OxLA or Crohn's Ox. Indo did not inhibit the stimulatory effect of OxLA on TBARS. NDGA reduced the amount of TBARS produced by OxLA in Crohn's cells, but the level was still significantly higher than DMEM control. These data demonstrate that the oxidizing solution induced oxidative stress, which was especially pronounced by OxLA in Crohn's cells.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Cellular levels of thiobarbituric acid reactive substances (TBARS) in normal or Crohn's HISM cells exposed to Ox, LA, Ox enriched with LA (OxLA), or OxLA + Indo (50 µM) or nordihydroguaiaretic acid (NDGA) (10 µM). Treatment of cells with Ox or OxLA induced cellular lipid peroxidation and oxidative stress, as evidenced by significantly increased levels of TBARS. Crohn's cells treated with OxLA had significantly higher levels of TBARS than normal cells treated with OxLA. [Data represent means ± SE; asignificantly higher than DMEM (P < 0.05); bsignificantly higher than normal OxLA (P < 0.05, n = 7)].

 

LA and IL-8

To test the second hypothesis that AA metabolites were mediators of the IL-8 response to LA, studies were done with LA and AA pathway inhibitors. Indo was used to inhibit synthesis of cyclooxygenase metabolites, and NDGA was used to inhibit synthesis of lipoxygenase metabolites. Treatment of HISM cells with LA caused a marked 27-fold increase in IL-8 secretion by Crohn's cells but not normal cells (Fig. 6). The oxidizing solution alone did not affect IL-8, but in conjunction with LA (i.e., OxLA), it increased IL-8 of normal cells to the levels observed in Crohn's cells treated with LA. Treatment of Crohn's cells with OxLA did not increase IL-8 over that of treatment with LA alone. The AA pathway inhibitors were evaluated with OxLA, because OxLA increased IL-8 in both normal and Crohn's HISM cells. Both Indo and NDGA inhibited the ability of OxLA to increase IL-8, implicating AA metabolites in the IL-8 response to LA.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 6. IL-8 production by normal or Crohn's HISM cells exposed to Ox, LA, OxLA, or OxLA + AA metabolite inhibitors, indomethacin (Indo; 50 µM) or NDGA (10 µM). Normal and Crohn's HISM cells were treated with Indo to inhibit cyclooxygenase and with NDGA to inhibit lipoxygenases. In Crohn's cells, LA markedly increased IL-8. Treatment with OxLA did not further increase IL-8 over that of LA for Crohn's cells. In normal cells, LA alone did not increase IL-8, but the combination of oxidative stress and LA (OxLA) did increase IL-8. Subjecting cells to oxidative stress without LA did not affect IL-8 in either normal or Crohn's cells. The ability of OxLA to increase IL-8 was prevented by both Indo and NDGA, suggesting that AA metabolites mediated the IL-8 response to LA. [Data represent means ± SE; asignificantly higher than DMEM (P < 0.05, n = 7)].

 

LA and AA Metabolites

To determine whether LA stimulated production of AA metabolites, representative metabolites were measured. OxLA stimulated production of both lipoxygenase (LTB4) and cyclooxygenase (PGE2, TXB2) metabolites (Fig. 7). OxLA significantly increased the production of LTB4 by both normal and Crohn's cells compared with LA alone or compared with the DMEM controls. Treatment of normal or Crohn's cells with NDGA significantly inhibited the ability of OxLA to stimulate LTB4 production, but Indo did not.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7. Leukotriene B4 (LTB4), PGE2, and thromboxane B2 (TXB2) production by normal and Crohn's HISM cells exposed to LA, OxLA, OxLA + Indo (50 µM), or OxLA + NDGA (10 µM). Treatment of normal or Crohn's HISM cells with OxLA resulted in significant increases in the production rates of LTB4, PGE2, and TXB2. Treatment of normal or Crohn's HISM cells with LA also resulted in a significant increase in the production of PGE2. Treatment of cells with Indo inhibited the ability of OxLA to stimulate PGE2 and TXB2 but not LTB4. Treatment with NDGA inhibited the ability of OxLA to stimulate LTB4 and TXB2 but not PGE2. Data represent means ± SE; asignificantly higher than DMEM (P < 0.05, n = 5).

 

Treatment of normal or Crohn's cells with either LA or OxLA resulted in a significant increase in the production of PGE2 compared with the DMEM controls. PGE2 production was reduced significantly when normal or Crohn's cells were treated with OxLA plus Indo. NDGA did not significantly inhibit the ability of OxLA to increase PGE2 either in normal or Crohn's cells.

TXB2 concentrations in the media of normal and Crohn's cells exposed to LA were two- to threefold higher than the DMEM controls (Fig. 7). OxLA caused a marked sevenfold increase in TXB2 secretion by normal cells and a fourfold increase by Crohn's cells. Treatment with Indo significantly inhibited the ability of OxLA to stimulate TXB2. Treatment with NDGA also inhibited TXB2.

AA and IL-8

To determine more specifically the role for AA metabolites in mediating the IL-8 response, normal HISM cells were incubated with AA, OxAA, OxAA plus PTA2, a selective thromboxane synthase inhibitor, and OxAA plus MK886, a selective 5-lipoxygenase inhibitor. Similar to OxLA, OxAA stimulated production of IL-8 as well as TXB2 (Fig. 8), PGE2 (data not shown), and LTB4 (Fig. 9). PTA2 inhibited in a dose-response manner the increases in TXB2 and IL-8 production induced by OxAA (Fig. 8). MK886 inhibited LTB4 and IL-8 production induced by OxAA also in a dose-response manner (Fig. 9).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 8. IL-8 and TXB2 production by normal HISM cells exposed to AA, OxAA, or OxAA + various doses of pinine thromboxane A2 (PTA2), a specific thromboxane synthase inhibitor. OxAA significantly increased IL-8 and TXB2 production compared with DMEM controls. PTA2 inhibited the ability of OxAA to stimulate IL-8 production and TXB2 production in a doseresponse manner. Data represent means ± SE; asignificantly higher than DMEM (P < 0.05); bsignificantly lower than OxAA (P < 0.05, n = 5).

 


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 9. IL-8 and LTB2 production by normal HISM cells exposed to AA, OxAA, or OxAA + various doses of MK886 (MK), a specific 5-lipoxygenase inhibitor. OxAA significantly increased IL-8 production and LTB2 production compared with DMEM controls. MK inhibited the ability of OxAA to stimulate IL-8 production and LTB2 production in a dose-response manner. Data represent means ± SE; asignificantly higher than DMEM (P < 0.05); bsignificantly lower than OxAA (P < 0.05, n = 6).

 

LTB4 and Thromboxane Receptors in HISM Cells

To ensure that HISM cells could respond to LTB4 and thromboxane, we assessed gene expression of receptors for LTB4 and TxA2. Figure 10 shows the gel electrophoresis of the RT-PCR products amplified using specific primers for LTB-R and TX-R. PCR products were present at the appropriate molecular weights for each receptor. Sequencing verified that the PCR products amplified were the desired sequence. Controls run without HISM cell cDNA were negative (data not shown). Therefore, it was concluded that HISM cells expressed transcripts corresponding to the receptors for both LTB4 and TxA2.



View larger version (96K):
[in this window]
[in a new window]
 
Fig. 10. Gene expression of the thromboxane A2-receptor (TX-R) and the LTB4-receptor (LTB-R) in cultured HISM cells. Specific sense and antisense primers were constructed from GenBank sequences to yield PCR products of ~200 bp. Products were analyzed by 1.5% agarose gel electrophoresis and visualized by ethidium bromide. HISM cells expressed appropriately sized products for both TX-R and LTB-R. Therefore, it was concluded that HISM cells contain receptors to mediate the actions of LTB4 and thromboxane in the regulation of IL-8.

 


    DISCUSSION
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In this study, we tested two hypotheses concerning the mechanism whereby LA induces IL-8 production by Crohn's HISM cells. One hypothesis was that LA stimulated activity of AA metabolizing enzymes that resulted in the generation of ROS, which activated NF-{kappa}B to increase transcription of the IL-8 gene. The other hypothesis was that LA stimulated production of AA metabolites, which enhanced IL-8 production.

To test the first hypothesis, we exposed normal and Crohn's HISM cells that were transfected with an NF-{kappa}B construct (BF2) to Ox or LA. In normal cells, Ox but not LA activated NF-{kappa}B. In Crohn's cells, NF-{kappa}B was spontaneously activated and was not further activated by LA or Ox. These results were confirmed by Western blot analysis. Spontaneous activation of NF-{kappa}B in Crohn's cells was demonstrated by the strong intensity of the bands of the p65 subunit in the nuclear extract. Treatment of normal cells with LA did not induce translocation of NF-{kappa}B from the cytosol to the nucleus, and treatment of Crohn's cells did not induce further translocation. There was no change in the intensity of the bands of cytosolic extracts vs. nuclear extracts when normal or Crohn's cells were treated with LA compared with untreated controls. The levels of the cytosolic NF-{kappa}B inhibitory binding protein I{kappa}B were also not affected by LA. These results do not support the first hypothesis that LA induces the activation of NF-{kappa}B to increase IL-8.

In contrast to LA, TNF-{alpha} significantly activated NF-{kappa}B in both normal and Crohn's cells. Several studies in Crohn's disease showed that mononuclear cells and macrophages isolated from the lamina propria expressed high levels of TNF-{alpha} (6, 41) and IL-1{beta} (24, 30, 32). Inflamed colonic mucosa obtained from patients with active Crohn's disease spontaneously produced increased amounts of TNF-{alpha}, IL-6, and IL-1{beta} compared with normal mucosa (8, 21, 39, 40). These cytokines are known to activate NF-{kappa}B (4) and are potential candidates for the spontaneous activation of NF-{kappa}B in Crohn's disease. Van Dullemen et al. (48) successfully treated established colitis in Crohn's patients by using an anti-TNF-{alpha} monoclonal antibody, which suggests a role for TNF-{alpha} in Crohn's disease.

The second hypothesis we tested was that AA metabolites mediated the IL-8 response to LA. There is evidence that AA metabolites of both the cyclooxygenase and lipoxygenase pathways affect IL-8 transcription by enhancing the action of NF-{kappa}B. In colon and intestinal epithelial cells, PGE2 enhances the transcriptional potential of the p65 subunit of NF-{kappa}B, PGE2 synergizes with TNF-{alpha} to promote IL-8 gene expression, and inhibition of COX-2 blocks nuclear accumulation of NF-{kappa}B (37). In endothelial cells, expression of leukocyte cell adhesion molecules induced by thromboxane is augmented by NF-{kappa}B (17). In human bronchial epithelial cells, LTB4 mediates histamine activation of NF-{kappa}B and increased expression of IL-8 (2).

Enhancement of NF-{kappa}B may explain why AA metabolites can mediate every step of inflammation (47) and thus may play an important role in the inflammation of Crohn's disease. Increased levels of AA in the intestinal mucosa and plasma of patients with Crohn's disease have been documented (7, 10, 11, 35, 36). The increased levels of AA in the intestinal mucosa of Crohn's patients is accompanied by an increase in phospholipase A2 (PLA2) levels and activity (26, 27, 33, 34), and there is increased COX-2 expression in the colonic epithelium (46). In active Crohn's disease, the colonic mucosa synthesizes large amounts of prostaglandins, thromboxane, and leukotrienes (14, 15, 20, 45). Increased synthesis of TXB2 is related to a significant reduction in the prostacyclin-to-thromboxane ratio even in areas of the mucosa without inflammation (14). Increased synthesis of LTB4 was suggested to play an important role because it is chemotactic for leukocytes (22).

To test the second hypothesis that AA metabolites are mediators of LA's enhancement of IL-8 production, we incubated normal and Crohn's HISM cells with Ox, LA, OxLA, and OxLA plus Indo to inhibit the cyclooxygenase pathway and OxLA plus NDGA to inhibit the lipoxygenase pathways. Exposure of cells to Ox or OxLA induced oxidative stress, as evidenced by increased cellular levels of TBARS. Crohn's cells were especially susceptible to oxidative stress induced by OxLA demonstrated by markedly higher levels of TBARS than normal cells. Oxidative stress alone (Ox) did not stimulate IL-8 production, but the combination of oxidative stress and LA (OxLA) did stimulate IL-8 production in normal and Crohn's cells. LA alone did not stimulate IL-8 production in normal cells, but it did in Crohn's cells. Therefore, LA increased the production of IL-8 only in situations where NF-{kappa}B was activated, either spontaneously in Crohn's cells or by Ox in normal cells. Inhibition of either the cyclooxygenase pathway with Indo or the lipoxygenase pathways with NDGA inhibited the ability of OxLA to increase IL-8, suggesting that AA metabolites were involved in the IL-8 response to LA.

To determine whether LA stimulated the production of AA metabolites, we measured representative cyclooxygenase (PGE2 and TXB2) and lipoxygenase (LTB4) metabolites. There was no difference in the spontaneous production of these metabolites between normal and Crohn's HISM cells except for TXB2, which was twofold higher in Crohn's cells. OxLA markedly stimulated the production of all three of these eicosanoids. Indo inhibited the ability of OxLA to stimulate the production of PGE2 and TXB2, and NDGA inhibited the production of LTB4. An unexpected observation was that NDGA also inhibited OxLA's ability to stimulate TXB2. NDGA is reported to be a specific inhibitor of the lipoxygenase enzymes.

To determine more specifically a role for AA metabolites, studies were done with AA. AA alone did not significantly stimulate IL-8, but when combined with oxidative stress (OxAA) there was a marked increase in IL-8. OxAA also stimulated PGE2, TXB2, and LTB4. The results with AA were similar to those with LA, and similar to LA, AA only stimulated IL-8 in situations in which NF-{kappa}B was activated. Treatments with specific AA pathway inhibitors were similar to the LA experiments with Indo and NDGA. Treatment with varying doses of PTA2, a selective thromboxane synthase inhibitor and receptor blocker, inhibited stimulation of TXB2 and IL-8 production by OxAA in a dose-response manner. MK886, a selective 5-lipoxygenase inhibitor, inhibited OxAA stimulation of LTB4 and IL-8 also in a dose-response manner.

To determine whether HISM cells contained receptors for LTB4 and thromboxane that could mediate their action on IL-8, we assessed gene expression. Analysis of specific gene products by RT-PCR revealed that HISM cells expressed receptors for both LTB4 and TxA2.

In summary, these data provide strong evidence that AA metabolites mediate the IL-8 response to LA in HISM cells. Both cyclooxygenase and lipoxygenase pathways are involved. Although LA does not increase IL-8 by activating NF-{kappa}B, NF-{kappa}B appears to be involved, because LA increased IL-8 only in situations in which NF-{kappa}B was activated either spontaneously in Crohn's cells or by inducing oxidative stress in normal cells. We speculate that LA increases IL-8 production by stimulating AA metabolites that enhance NF-{kappa}B-dependent transcription of IL-8. These data suggest that dietary restriction of LA, antioxidant supplementation, and treatment with AA pathway inhibitors may be beneficial for treating Crohn's patients.


    ACKNOWLEDGMENTS
 
GRANTS

This work was supported in part by National Institute of Health Grants HL-069851 (to S. W. Walsh), HL-61359 (to A. A. Fowler III), GM-58530 (to D. R. Yager), and DK-34151 (to M. F. Graham).


    FOOTNOTES
 

Address for reprint requests and other correspondence: S. W. Walsh, Virginia Commonwealth Univ., Dept. of Obstetrics and Gynecology, P.O. Box 980034, Richmond, VA 23298-0034 (E-mail: swwalsh{at}vcu.edu).

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.


    REFERENCES
 TOP
 ABSTRACT
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Alzoghaibi MA, Walsh SW, Willey A, Fowler AA 3rd, and Graham MF. Linoleic acid, but not oleic acid, upregulates the production of interleukin-8 by human intestinal smooth muscle cells isolated from patients with Crohn's disease. Clin Nutr. 22: 529-535, 2003.[CrossRef][ISI][Medline]
  2. Aoki Y, Qiu D, Zhao GH, and Kao PN. Leukotriene B4 mediates histamine induction of NF-{kappa}B and IL-8 in human bronchial epithelial cells. Am J Physiol Lung Cell Mol Physiol 274: L1030-L1039, 1998.[Abstract/Free Full Text]
  3. Baldwin AS Jr. The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu Rev Immunol 14: 649-683, 1996.[CrossRef][ISI][Medline]
  4. Barnes PJ and Karin M. Nuclear factor-{kappa}B: a pivotal transcription factor in chronic inflammatory diseases. N Engl J Med 336: 1066-1071, 1997.[Free Full Text]
  5. Brandt E, Colombel JF, Ectors N, Gambiez L, Emilie D, Geboes K, Capron M, and Desreumaux P. Enhanced production of IL-8 in chronic but not in early ileal lesions of Crohn's disease (CD). Clin Exp Immunol 122: 180-185, 2000.[CrossRef][ISI][Medline]
  6. Breese EJ, Michie CA, Nicholls SW, Murch SH, Williams CB, Domizio P, Walker-Smith JA, and MacDonald TT. Tumor necrosis factor {alpha}-producing cells in the intestinal mucosa of children with inflammatory bowel disease. Gastroenterology 106: 1455-1466, 1994.[ISI][Medline]
  7. Buhner S, Nagel E, Korber J, Vogelsang H, Linn T, and Pichlmayr R. Ileal and colonic fatty acid profiles in patients with active Crohn's disease. Gut 35: 1424-1428, 1994.[Abstract/Free Full Text]
  8. Casini-Raggi V, Kam L, Chong YJ, Fiocchi C, Pizarro TT, and Cominelli F. Mucosal imbalance of IL-1 and IL-1 receptor antagonist in inflammatory bowel disease. A novel mechanism of chronic intestinal inflammation. J Immunol 154: 2434-2440, 1995.[Abstract]
  9. Daig R, Andus T, Aschenbrenner E, Falk W, Scholmerich J, and Gross V. Increased interleukin 8 expression in the colon mucosa of patients with inflammatory bowel disease. Gut 38: 216-222, 1996.[Abstract/Free Full Text]
  10. Esteve-Comas M, Nunez MC, Fernandez-Banares F, Abad-Lacruz A, Gil A, Cabre E, Gonzalez-Huix F, Bertran X, and Gassull MA. Abnormal plasma polyunsaturated fatty acid pattern in non-active inflammatory bowel disease. Gut 34: 1370-1373, 1993.[Abstract/Free Full Text]
  11. Esteve-Comas M, Ramirez M, Fernandez-Banares F, Abad-Lacruz A, Gil A, Cabre E, Gonzalez-Huix F, Moreno J, Humbert P, Guilera M, Boix J, and Gassull MA. Plasma polyunsaturated fatty acid pattern in active inflammatory bowel disease. Gut 33: 1365-1369, 1992.[Abstract/Free Full Text]
  12. Fowler AA 3rd, Fisher BJ, Sweeney LB, Wallace TJ, Natarajan R, Ghosh SS, and Ghosh S. Nitric oxide regulates interleukin-8 gene expression in activated endothelium by inhibiting NF-{kappa}B binding to DNA: effects on endothelial function. Biochem Cell Biol 77: 201-208, 1999.[CrossRef][ISI][Medline]
  13. Graham MF, Diegelmann RF, Elson CO, Bitar KN, and Ehrlich HP. Isolation and culture of human intestinal smooth muscle cells. Proc Soc Exp Biol Med 176: 503-507, 1984.[Abstract]
  14. Hawkey CJ, Karmeli F, and Rachmilewitz D. Imbalance of prostacyclin and thromboxane synthesis in Crohn's disease. Gut 24: 881-885, 1983.[Abstract/Free Full Text]
  15. Hommes DW, Meenan J, de Haas M, ten Kate FJ, von dem Borne AE, Tytgat GN, and van Deventer SJ. Soluble Fc gamma receptor III (CD 16) and eicosanoid concentrations in gut lavage fluid from patients with inflammatory bowel disease: reflection of mucosal inflammation. Gut 38: 564-567, 1996.[Abstract/Free Full Text]
  16. Ina K, Kusugami K, Yamaguchi T, Imada A, Hosokawa T, Ohsuga M, Shinoda M, Ando T, Ito K, and Yokoyama Y. Mucosal interleukin-8 is involved in neutrophil migration and binding to extracellular matrix in inflammatory bowel disease. Am J Gastroenterol 92: 1342-1346, 1997.[ISI][Medline]
  17. Ishizuka T, Kawakami M, Hidaka T, Matsuki Y, Takamizawa M, Suzuki K, Kurita A, and Nakamura H. Stimulation with thromboxane A2 (TXA2) receptor agonist enhances ICAM-1, VCAM-1 or ELAM-1 expression by human vascular endothelial cells. Clin Exp Immunol 112: 464-470, 1998.[CrossRef][ISI][Medline]
  18. Jentzsch AM, Bachmann H, Furst P, and Biesalski HK. Improved analysis of malondialdehyde in human body fluids. Free Radic Biol Med 20: 251-256, 1996.[CrossRef][ISI][Medline]
  19. Kukreja RC, Kontos HA, Hess Ml, and Ellis EF. PGH synthase and lipoxygenase generate superoxide in the presence of NADH or NADPH. Circ Res 59: 612-619, 1986.[Abstract/Free Full Text]
  20. Lauritsen K, Laursen LS, Bukhave K, and Rask-Madsen J. In vivo profiles of eicosanoids in ulcerative colitis, Crohn's colitis, and Clostridium difficile colitis. Gastroenterology 95: 11-17, 1988.[ISI][Medline]
  21. Ligumsky M, Simon PL, Karmeli F, and Rachmilewitz D. Role of interleukin 1 in inflammatory bowel disease–enhanced production during active disease. Gut 31: 686-689, 1990.[Abstract/Free Full Text]
  22. Lobos EA, Sharon P, and Stenson WF. Chemotactic activity in inflammatory bowel disease. Role of leukotriene B4. Dig Dis Sci 32: 1380-1388, 1987.[CrossRef][ISI][Medline]
  23. Luster AD. Chemokines–chemotactic cytokines that mediate inflammation. N Engl J Med 338: 436-445, 1998.[Free Full Text]
  24. Mahida YR, Wu K, and Jewell DP. Enhanced production of interleukin 1{beta} by mononuclear cells isolated from mucosa with active ulcerative colitis of Crohn's disease. Gut 30: 835-838, 1989.[Abstract/Free Full Text]
  25. Mazzucchelli L, Hauser C, Zgraggen K, Wagner H, Hess M, Laissue JA, and Mueller C. Expression of interleukin-8 gene in inflammatory bowel disease is related to the histological grade of active inflammation. Am J Pathol 144: 997-1007, 1994.[Abstract]
  26. Minami T, Tojo H, Shinomura Y, Matsuzawa Y, and Okamoto M. Increased group II phospholipase A2 in colonic mucosa of patients with Crohn's disease and ulcerative colitis. Gut 35: 1593-1598, 1994.[Abstract/Free Full Text]
  27. Minami T, Tojo H, Shinomura Y, Tarui S, and Okamoto M. Raised serum activity of phospholipase A2 immunochemically related to group II enzyme in inflammatory bowel disease: its correlation with disease activity of Crohn's disease and ulcerative colitis. Gut 33: 914-921, 1992.[Abstract/Free Full Text]
  28. Mitsuyama K, Toyonaga A, Sasaki E, Watanabe K, Tateishi H, Nishiyama T, Saiki T, Ikeda H, Tsuruta O, and Tanikawa K. IL-8 as an important chemoattractant for neutrophils in ulcerative colitis and Crohn's disease. Clin Exp Immunol 96: 432-436, 1994.[ISI][Medline]
  29. Mosmann T. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J Immunol Methods 65: 55-63, 1983.[CrossRef][ISI][Medline]
  30. Nakamura M, Saito H, Kasanuki J, Tamura Y, and Yoshida S. Cytokine production in patients with inflammatory bowel disease. Gut 33: 933-937, 1992.[Abstract/Free Full Text]
  31. Natarajan R, Ghosh S, Fisher BJ, Diegelmann RF, Willey A, Walsh S, Graham MF, and Fowler AA 3rd. Redox imbalance in Crohn's disease intestinal smooth muscle cells causes NF-{kappa}B-mediated spontaneous interleukin-8 secretion. J Interferon Cytokine Res 21: 349-359, 2001.[CrossRef][ISI][Medline]
  32. Neurath MF, Fuss I, Schurmann G, Pettersson S, Arnold K, Muller-Lobeck H, Strober W, Herfarth C, and Buschenfelde KH. Cytokine gene transcription by NF-{kappa} B family members in patients with inflammatory bowel disease. Ann NY Acad Sci 859: 149-159, 1998.[CrossRef][ISI][Medline]
  33. Olaison G, Leandersson P, Sjodahl R, and Tagesson C. Increase in permeability and phospholipase A2 activity of colonic mucosa in Crohn's colitis. Digestion 43: 228-233, 1989.[ISI][Medline]
  34. Olaison G, Sjodahl R, and Tagesson C. Increased phospholipase A2 activity of Ileal mucosa in Crohn's disease. Digestion 41: 136-141, 1988.[ISI][Medline]
  35. Pacheco S, Hillier K, and Smith C. Increased arachidonic acid levels in phospholipids of human colonic mucosa in inflammatory bowel disease. Clin Sci (Lond) 73: 361-364, 1987.[Medline]
  36. Pereira SP, Cassell TB, Engelman JL, Sladen GE, Murphy GM, and Dowling RH. Plasma arachidonic acid-rich phospholipids in Crohn's disease: response to treatment. Clin Sci (Lond) 91: 509-512, 1996.[Medline]
  37. Poligone B and Baldwin AS. Positive and negative regulation of NF-{kappa}B by COX-2: roles of different prostaglandins. J Biol Chem 276: 38658-38664, 2001.[Abstract/Free Full Text]
  38. Pullman WE, Sullivan PJ, Barratt PJ, Lising J, Booth JA, and Doe WF. Assessment of inflammatory bowel disease activity by technetium 99m phagocyte scanning. Gastroenterology 95: 989-996, 1988.[ISI][Medline]
  39. Reimund JM, Wittersheim C, Dumont S, Muller CD, Baumann R, Poindron P, and Duclos B. Mucosal inflammatory cytokine production by intestinal biopsies in patients with ulcerative colitis and Crohn's disease. J Clin Immunol 16: 144-150, 1996.[CrossRef][ISI][Medline]
  40. Reimund JM, Wittersheim C, Dumont S, Muller CD, Kenney JS, Baumann R, Poindron P, and Duclos B. Increased production of tumour necrosis factor-{alpha} interleukin-1 beta, and interleukin-6 by morphologically normal intestinal biopsies from patients with Crohn's disease. Gut 39: 684-689, 1996.[Abstract/Free Full Text]
  41. Reinecker HC, Steffen M, Witthoeft T, Pflueger I, Schreiber S, MacDermott RP, and Raedler A. Enhanced secretion of tumour necrosis factor-{alpha}, IL-6, and IL-1{beta} by isolated lamina propria mononuclear cells from patients with ulcerative colitis and Crohn's disease. Clin Exp Immunol 94: 174-181, 1993.[ISI][Medline]
  42. Saverymuttu SH, Peers AM, Lavender JP, Chadwick VS, and Hodgson HJ. In vivo assessment of granulocyte migration to diseased bowel in Crohn's disease. Gut 26: 378-383, 1985.[Abstract/Free Full Text]
  43. Schreck R, Rieber P, and Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-{kappa} B transcription factor and HIV-1. EMBO J 10: 2247-2258, 1991.[ISI][Medline]
  44. Sen CK and Packer L. Antioxidant and redox regulation of gene transcription. FASEB J 10: 709-720, 1996.[Abstract]
  45. Sharon P and Stenson WF. Enhanced synthesis of leukotriene B4 by colonic mucosa in inflammatory bowel disease. Gastroenterology 86: 453-460, 1984.[ISI][Medline]
  46. Singer II, Kawka DW, Schloemann S, Tessner T, Riehl T, and Stenson WF. Cyclooxygenase 2 is induced in colonic epithelial cells in inflammatory bowel disease. Gastroenterology 115: 297-306, 1998.[CrossRef][ISI][Medline]
  47. Spector AA and Yorek MA. Membrane lipid composition and cellular function. J Lipid Res 26: 1015-1035, 1985.[Abstract]
  48. Van Dullemen HM, van Deventer SJ, Hommes DW, Bijl HA, Jansen J, Tytgat GN, and Woody J. Treatment of Crohn's disease with antitumor necrosis factor chimeric monoclonal antibody (cA2). Gastroenterology 109: 129-135, 1995.[CrossRef][ISI][Medline]
  49. Walsh SW, Vaughan JE, Wang Y, and Roberts LJ II. Placental isoprostane is significantly increased in preeclampsia. FASEB J 14: 1289-1296, 2000.[Abstract/Free Full Text]
  50. Winyard PG and Blake DR. Antioxidants, redox-regulated transcription factors, and inflammation. Adv Pharmacol 38: 403-421, 1997.[Medline]
  51. Yamada T and Grisham MB. Role of neutrophil-derived oxidants in the pathogenesis of intestinal inflammation. Klin Wochenschr 69: 988-994, 1991.[CrossRef][ISI][Medline]



This article has been cited by other articles:


Home page
CarcinogenesisHome page
F. Biasi, C. Mascia, and G. Poli
The contribution of animal fat oxidation products to colon carcinogenesis, through modulation of TGF-{beta}1 signaling
Carcinogenesis, May 1, 2008; 29(5): 890 - 894.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
M. Hinton, A. Gutsol, and S. Dakshinamurti
Thromboxane hypersensitivity in hypoxic pulmonary artery myocytes: altered TP receptor localization and kinetics
Am J Physiol Lung Cell Mol Physiol, March 1, 2007; 292(3): L654 - L663.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. H. C. Serezani, D. M. Aronoff, S. Jancar, and M. Peters-Golden
Leukotriene B4 mediates p47phox phosphorylation and membrane translocation in polyunsaturated fatty acid-stimulated neutrophils
J. Leukoc. Biol., October 1, 2005; 78(4): 976 - 984.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. E. Ducale, S. I. Ward, T. Dechert, and D. R. Yager
Regulation of hyaluronan synthase-2 expression in human intestinal mesenchymal cells: mechanisms of interleukin-1{beta}-mediated induction
Am J Physiol Gastrointest Liver Physiol, September 1, 2005; 289(3): G462 - G470.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract