HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (15) Citing Articles via Google Scholar Google Scholar Articles by Radanovic, T. Articles by Biber, J. Search for Related Content PubMed PubMed Citation Articles by Radanovic, T. Articles by Biber, J.

MUCOSAL BIOLOGY

Regulation of Intestinal Phosphate Transport I. Segmental expression and adaptation to low-P_i diet of the type IIb Na⁺-P_i cotransporter in mouse small intestine

Institute of Physiology, University Zürich, Zürich, Switzerland

Submitted 16 April 2004 ; accepted in final form 21 October 2004

	ABSTRACT

TOP ABSTRACT METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
The Na⁺-P_i cotransporter NaPi-IIb (SLC34A2) has been described to be involved in mouse small intestinal absorption of P_i and to be regulated by a number of hormones and metabolic factors. However, a possible segmental expression of NaPi-llb in small intestine has not been addressed so far. Here, we describe that the NaPi-IIb cotransporter is highly abundant in the ileum of mouse small intestine, whereas it is almost absent in the duodenum and in the jejunum. Na⁺-P_i cotransport studies with isolated brush border membranes confirmed that NaPi-IIb cotransport is highest in the ileum. Upregulation by a low-phosphate diet of NaPi-IIb and NaPi-IIb cotransport was observed both in the jejunum and the ileum. Furthermore, evidence is provided that a low-phosphate diet provokes an increase of the NaPi-IIb mRNA abundance along the entire small intestine. These data suggest that in mouse small intestine, phosphate is absorbed transcellulary by an Na⁺-dependent pathway in the ileum, whereas in the duodenum and jejunum, this pathway is of minimal importance. Furthermore, we conclude that along the entire mouse small intestine, low-phosphate diet affects transcription and/or the stability of NaPi-IIb mRNA.

enterocytes; sodium-inorganic phosphate cotransport; phosphate diet

Transcellular intestinal absorption of P_i is initiated by a sodium-dependent transport of P_i across the apical (brush border) membrane as has been demonstrated with intact tissue preparations or isolated brush border membrane vesicles (BBMV) (5, 7). Independent of the technique and species used, the apparent K_m value for P_i was reported to be between 0.1 and 0.2 mM, and lowering the external pH value resulted in a modest increase of the transport rate. Furthermore, intestinal Na⁺-dependent absorption of P_i is regulated by a number of hormones and metabolic factors such as 1,25-dihydoxy-vitamin D₃ [1,25(OH)₂D] and low dietary intake of P_i (5, 7, 10, 14).

The Na⁺-P_i cotransporter NaPi-IIb, a member of the type II Na⁺-P_i cotransporter family SLC34 (16), was shown to be localized at the apical membrane of enterocytes (11). After heterologous expression of NaPi-IIb in Xenopus laevis oocytes, it has been demonstrated that NaPi-IIb-mediated P_i transport is obligatory dependent on the presence of sodium and exhibits apparent K_m values of 50 µM for P_i and 40 mM for sodium ions. On the basis of these results, it was concluded that transcellular Na⁺-dependent absorption of P_i in the intestine is initiated by the Na⁺-P_i cotransporter NaP-llb (9). The abundance of the type IIb Na⁺-P_i cotransporter was shown to be regulated by a low-P_i diet, 1,25(OH)₂D (9, 12), glucocorticoid (1), estrogen (23), the epidermal growth factor (22), aging (21), and metabolic acidosis (17a). However, except in the latter study, a possible segmental distribution of the NaPi-llb expression along the small intestine has not been addressed. Several in vivo and in vitro studies documented that the majority of phosphate is reabsorbed in the duodenum and/or early jejunum (5, 7, 14). However, the possibility that considerable P_i absorption occurs also in the ileum has been reported as well. This was explained (e.g., in rats) by a longer dwell time when compared with the duodenal/jejunal transit (13, 14).

Here, we show that in mouse small intestine, NaPi-IIb is expressed in the ileum and that NaPi-IIb is almost absent in the duodenum and in the jejunum. Segmental expression of NaPi-IIb was confirmed by NaPi-IIb cotransport experiments using purified BBMVs, Western blot analyses, and real-time PCR. Adaptation to a low-P_i diet resulted in an increase of the abundance of NaPi-IIb protein in the jejunum and the ileum. In addition, and in contrast to earlier studies (9, 12), low-P_i diet led to an increase of the abundance of NaPi-IIb mRNA, indicating that upregulation of the NaPi-IIb protein involves a transcriptional mechanism or an increased stability of the mRNA.

	METHODS

TOP ABSTRACT METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Animal studies. All experiments were performed with adult (10- to 12-wk old) male NMRI mice purchased from Charles River Laboratories (Germany). After arrival, the animals were fed with a normal laboratory chow. Normal drinking water was supplied ad libitum. For adaptation to dietary phosphate (P_i), animals were fed for 5 days with diets containing either high P_i (1.1%) or low P_i (0.1%; Provimi Kliba, Kaiseraugst, Switzerland). All experiments were conducted according to the guidelines of the Veterinäramt of the Kanton Zürich/Switzerland.

Isolation of BBMVs and transport studies. Small intestines were removed from animals, rinsed with ice-cold 0.9% NaCl, and inverted using a thin metal stick. The mucosa was scraped off from individual intestinal segments (duodenum = first centimeter; jejunum = 2–15 cm; and ileum = last 25 cm) or from whole small intestine and homogenized (Omnimixer, setting 6, 90 s) in 15 ml of 300 mM mannitol, 5 mM EGTA, 5 mM HEPES/Tris (pH 7.1), and 0.1 mM phenylmethylsulfonyl fluoride at 4°C. After dilution with 20 ml of cold water, BBMV were prepared by the Mg²⁺-precipitation technique as described (18). Final membranes were resuspended in 300 mM mannitol, 20 mM HEPES/Tris (pH 7.2) at a concentration of 10–15 mg total protein, which was determined according to Bradford (3). Each preparation contained membranes from small intestines of three to four animals.

The transport rate of phosphate into BBMV was measured as described (10) at 25°C in the presence of inwardly directed gradients of 100 mM NaCl or 100 mM KCl and 0.3 mM K-phosphate. Phosphate uptake was determined after 90 s and after 90 min to determine the equilibrium values.

Western blot analysis. Depending on the origin, 30–60 µg of purified BBMVs were separated by 10% SDS-PAGE after denaturation, without heating, in 2% SDS, 1 mM EDTA, 10% glycerol, 85 mM Tris·HCl (pH 6.8). After transfer of separated proteins onto nitrocellulose membranes, membranes were blocked with 5 phenylmethylsulfonyl fluoride nonfat milk powder and 0.5% Triton X-100 in TBS (150 mM NaCl, 25 mM Tris·HCl, pH 7.3) for 2 h. NaPi-IIb was detected with a rabbit polyclonal antiserum raised against a synthetic peptide derived from the NH₂ terminus of NaPi-IIb (11). A polyclonal anti-calbindin D9k antibody was purchased from Swant (Bellinzona, Switzerland; dilution 1:10,000). -actin, which was used as a loading control, was detected either by a staining with Ponceau rouge or by using a monoclonal anti--actin antibody (Sigma, St. Louis, MO; dilution 1:6,000). Binding of primary antibodies was visualized with anti-rabbit or anti-mouse IgG antibodies conjugated to horseradish peroxidase (Amersham Pharmacia Biotech, Germany) and enhanced chemiluminescence (Pierce, Switzerland). Denistometric analysis was performed using the imaging system Diana III and analyzed with the Aida software (Raytest, Germany).

Immunofluorescence. For immunohistochemistry, samples (0.5 cm) from the small intestine were taken every 5 cm (starting at the stomach pylorus) along the whole small intestine and were fixed by immersion. The fixative was composed of 3% paraformaldehyde and 0.05% picric acid in a 6:4 mixture of 0.1 M cacodylate buffer (pH 7.4, adjusted to 300 mosm/kgH₂O with sucrose) and 10% hydroxyethyl starch in saline (HAES steril; Fresenius, Bad Homburg, Germany) (2). After 4 h, the samples were washed twice with PBS (140 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄, pH 7.3), frozen rapidly after cryoprotection, and stored at –80°C. Cryosections (4–5 µm) were processed for immunofluorescence as reported (6). Briefly, after pretreatment for 30 min in PBS containing 3% defatted milk powder and 0.2% Triton X-100, samples were incubated overnight at 4°C with an anti-rabbit polyclonal antibody against the NaPi-IIb protein at a dilution 1:250. Sections were then incubated for 30 min with swine anti-rabbit IgG conjugated to FITC (Dakopatts, Glostrup, Denmark) at a dilution 1:50 (room temperature). Finally, the sections were covered with coverslips using DAKO-Glycergel (Dakopatts), containing 2.5% 1,4-diazabicyclo (2.2.2.) octane (DABCO; Sigma) as a fading retardant, and analyzed on a fluorescence microscope (Nikon Eclipse TE300).

Real-time PCR. Total RNA from jejunal and ileal mucosa (30 mg) was extracted using RNeasy Mini Kit (Qiagen, Cologne, Germany) according to manufacturer’s instructions. First-strand cDNA synthesis from total RNA was made in a reaction volume of 50 µl using TaqMan reverse transcription reagents (Applied Biosystems) with random hexamers according to the manufacturer’s instructions. Relative quantitation of NaPi-IIb mRNA was done using the ABI PRISM 7700 Sequence Detection System (Applied Biosystems) with -actin as an internal standard. The sequences of TaqMan probes (Applied Biosystems, for NaPi-IIb; Biosearch Technologies, for -actin) and primers (Applied Biosystems, for NaPi-IIb; Microsynth, Switzerland for -actin) were as follows: 5'-(6-FAM) TGGTCAGAGAGAGACAC (BHQ-1)-3' (probe), 5'-CCTGGGACCTGCCTGAACT-3' (forward), 5'-AATGCAGAGCGTCTTCCCTTT-3' (reverse) for NaPi-IIb, and 5'-(6-FAM) CCATGAAGATCAAGATCATTGCTCCTCCT (BHQ-1)-3' (probe), 5'-GACAGGATGCAGAAGGAGATTACTG-3' (forward), 5'-CCACCGATCCACACAGAGTACTT-3' (reverse) for -actin. TaqMan probes were set across exon-exon boundaries to exclude any amplification of genomic DNA. PCR reactions in a volume of 25 µl, containing 900 nM gene specific primers and 250 nM probes, were performed using TaqMan Universal PCR Master Mix (Applied Biosystems). After incubation with uracil-N-glycosylase (2 min at 50°C) and activation of AmpliTaq Gold DNA polymerase (10 min at 95°C), the samples were amplified by 45 cycles at 95°C for 15 s and 60°C for 1 min. Relative expression was calculated according to user bulletin #2 of the ABI PRISM 7700 Sequence Detection System (available for download at http://home.appliedbiosystems.com).

Statistics. All data (means ± SD) were tested for significance by applying the unpaired Student’s t-test. Differences at the level of P < 0.05 were considered as significant.

	RESULTS

TOP ABSTRACT METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
The distribution of NaPi-IIb along the small intestine of male adult mice that were fed with a normal laboratory chow containing 0.8% of P_i, was assessed by immunofluorescence. As illustrated in Fig. 1, strong, NaPi-IIb-related immunostaining was observed at the brush borders of enterocytes in the ileum. In the jejunum (between 5 and 15 cm), NaPi-IIb-mediated immunostaining was barely detectable, whereas in the duodenum, NaPi-llb staining was faint and often scattered. Immunoblots performed with BBMVs isolated from the different intestinal segments are shown in Fig. 2. The highest abundance of NaPi-llb was detected in BBMV derived from the ileum. In BBMV isolated from the jejunum, NaPi-llb protein was barely detectable, and in BBMV obtained from the duodenum, NaPi-llb protein could never be detected by Western blot analysis. Next, Na⁺/P_i uptake studies were performed using BBMV isolated from the different segments. As shown in Fig. 2, significant Na⁺-dependent phosphate uptake was observed only in BBMV derived from the ileum. No significant Na-dependent P_i uptake was observed in BBMV derived from the duodenum or the jejunum.

View larger version (138K): [in this window] [in a new window]   Fig. 1. Distribution of the NaPi-IIb protein along mouse small intestine. At various distances (indicated in cm) starting from the pylorus, small intestinal rings were recovered and analyzed by immunofluorescence. Strong NaPi-llb-related immunofluorescence was observed at the apical site of enterocytes in the ileum (20–45 cm), whereas in the jejunum (5–15 cm), no immunostaining was detected. In the duodenum, the staining was faint and scattered. Phase contrast images are displayed to ensure for the intactness of the brush borders. *, Nonspecific staining of goblet cells.

View larger version (29K): [in this window] [in a new window]   Fig. 2. Pi uptake and NaPi-IIb abundance in brush border membrane vesicles (BBMV) isolated from the jejunum or the ileum of mouse small intestine. As indicated, Pi uptake was determined in the presence of 100 mM NaCl or KCl. In all BBMV preparations, Na+-independent Pi uptakes and equilibrium values (taken after 90 min) were similar. The data represent the means ± SD of 4 uptake determinations. Three independent experiments with similar results were performed. Significant (*P < 0.05) Na-dependent Pi uptake was observed only in BBMV derived from the ileum. The same BBMV preparations (50 µg) were analyzed by Western blot analysis for NaPi-llb and as a control for -actin. NS, not significant.

Na⁺-dependent uptake of P_i into BBMV isolated from the jejunum or ileum of the differently fed mice is shown in Fig. 3. In BBMV isolated from mice fed with a high-P_i diet, the rates of NaPi-IIb cotransport did not differ from the ones observed in BBMV isolated from animals fed with a normal diet (compare with Fig. 2). In both jejunal and ileal BBMV prepared from mice fed a low-P_i diet, Na⁺-dependent uptake of P_i was increased compared with BBMV isolated from mice fed a high-P_i diet (Fig. 3). Western blot analysis of the respective BBMV preparations is shown in Fig. 4 and demonstrates that in both jejunal and ileal BBMVs, low-P_i diet provoked an increase of the abundance of the NaPi-IIb protein. In agreement with the increase of NaPi-IIb cotransport observed in ileal BBMV, the increase of the NaPi-llb/-actin ratio was 2.7 ± 0.9 (n = 3). After adaptation to a low-P_i diet for 5 days, NaPi-llb protein could not be detected BBMV isolated from the duodenum (data not shown). In addition to male mice, BBMV were also isolated from the jejunum and ileum of female mice. On the basis of Western blots (Fig. 4A), there was no difference between the distribution patterns (jejunum vs. ileum) of the NaPi-IIb protein between males and females. Also, there was no difference in the adaptive effect of low-P_i diet between the two genders. Additionally, BBMV were analyzed for the abundance of calbindin D9k (Fig. 4B). As shown, calbindin D9k was abundant in jejunal BBMV but absent in ileal BBMV derived from animals fed a high-P_i diet. Low-P_i diet provoked an increase of calbindin D9k, which was clearly detectable in ileal BBMVs.

View larger version (11K): [in this window] [in a new window]   Fig. 3. Pi uptake into BBMV isolated from mice fed either with a high- or a low-Pi diet for 5 days. Uptake of Pi was determined in the presence of 100 mM KCl (open bars) or in the presence of 100 mM NaCl (filled bars). Means ± SD of 4 determinations are shown; 3 independent experiments were performed. Signifcant (*P < 0.05) increase of Pi uptake in the presence of NaCl was observed in both BBMV populations.

View larger version (35K): [in this window] [in a new window]   Fig. 4. Western blot (WB) analysis for NaPi-IIb (A) or calbindin D9k (B) with BBMV isolated from male (m) and female (f) mice fed with a high- or a low-Pi diet. Loadings were 30 µg for ileal and 65 µg for jejunal BBMV. The band of -actin [visualized with ponceau rouge (PR)] served as a loading control.

View larger version (13K): [in this window] [in a new window]   Fig. 5. Real-time PCR analysis of NaPi-IIb mRNA of small intestinal mucosa of animals fed a high- or a low-Pi diet. The data represent results obtained with samples obtained from 3 different animals of each condition (open, cross-hatched, and filled bars, respectively). The relative abundance of NaPi-llb mRNA is given as the ratio of the NaPi-llb mRNA over -actin mRNA (means ± SD of 3 determinations). The Ct values for -actin were similar in all samples analyzed.

	DISCUSSION

TOP ABSTRACT METHODS RESULTS DISCUSSION GRANTS REFERENCES

In this study, expression of NaPi-llb and its correlation with Na/P_i cotransport activity was assessed in the small intestine of mouse. Interestingly, the highest amount of NaPi-IIb protein was detected in the ileum, whereas in the jejunum, the content of the NaPi-IIb protein was minimal. In agreement, the highest rate of NaPi-IIb cotransport was observed in BBMV isolated from the ileum, whereas in BBMV, isolated from the jejunum, Na⁺-dependent transport of P_i was not measurable. Although apical NaPi-llb was detectable by immunofluorescence in the duodenum, NaPi-llb could not be detected on immunoblots. Also, no Na-dependent P_i uptake could be measured in BBMV isolated from the duodenum. Thus the described localization of NaPi-llb suggests that in mouse small intestine, transcellular, Na⁺-dependent absorption of P_i occurs, to a large extent, in the ileum and is only minimal in the jejunum and duodenum. These data are in agreement with P_i-flux measurements, showing that P_i absorption in mice intestine is highest in the ileum and occurs only minimally in the other segments (E. Debnam, personal communication). Interestingly, it has been shown that in rat small intestine, when considering the different transit times, P_i is absorbed to equal extents (1/3 of ingested P_i) in the ileum and in the duodenum (13). However, rat small intestinal localization of the NaPi-llb cotransporter remains to be determined.

Different factors have been described to regulate small intestinal P_i absorption (for review, see Refs. 5, 7, 14). In recent years, it has been shown that most of these factors alter the abundance of the NaPi-IIb protein in the apical membrane of the enterocytes (1, 9, 12, 21–23). Here, we show that the abundance of the NaPi-IIb protein and of NaPi-IIb cotransport is increased by a low-P_i diet in the jejunum and in the ileum. In the duodenum, no evidence for an increase of these parameters was obtained. Furthermore, and in contrast to earlier reports (9, 12), an increase of the NaPi-llb mRNA content was observed in all intestinal segments; similar findings have been reported recently (17). Whereas in the jejunum and ileum, an increase of the NaPi-llb mRNA content was paralleled by an increase of the NaPi-llb protein, for reasons that cannot be explained, such a parallism could not be observed in the duodenum.

The effect of a low-P_i diet on NaPi-IIb mRNA suggests that the regulation of intestinal P_i absorption occurs via a transcriptional mechanism or via an increased stability of NaPi-IIb mRNA. Currently, neither the signal(s) nor the mechanism(s) leading to an increased amount of NaPi-IIb mRNA is known. Regulation of small intestinal NaPi-IIb cotransport by a low-P_i diet is assumed to be dependent on the stimulation of the renal 25-hydroxyvitamin-D₃-1-hydroxylase activity and the resulting increase of the serum concentration of 1,25(OH)₂D (5, 19). Consequently, an increase of NaPi-IIb mRNA may be explained by a transcriptional regulation that involves the vitamin D receptor (VDR), similar to what was described for calbindin D9k (15). Indeed, upregulation of the latter by a low-P_i diet was detectable in ileal BBMV (see Fig. 4B). However, an involvement of VDR in the regulation by low-P_i diet of NaPi-IIb in intestine has recently been challenged because it was shown that upregulation of NaPi-IIb protein and mRNA was not altered in VDR-deficient mice compared with wild-type mice (4, 17). Thus, if 1,25(OH)₂D acts via a nongenomic mechanism (8) or if other factors, such as, for example, FGF23 (20), may be involved in the upregulation by a low-P_i diet of intestinal P_i absorption remains to be determined.

In summary, our data demonstrate that along the mouse small intestine, the Na⁺-P_i cotransporter NaPi-IIb is inhomogenously expressed. The highest abundance of NaPi-IIb protein was found in the ileum, whereas in the duodenum and in the jejunum, the content of the NaPi-IIb protein was minimal or not detectable. On the basis of Na-P_i-transport studies, we conclude that in mouse small intestine, transcellular P_i reabsorption occurs to a significant amount in the ileum. Whether such segmental distribution of NaPi-IIb and Na/P_i cotransport is unique for the mouse small intestine or may also be present in other species remains to be analyzed.

	GRANTS

TOP ABSTRACT METHODS RESULTS DISCUSSION GRANTS REFERENCES

 
Financial support was provided by Swiss National Funds Grant 31–61438.00 (to J. Biber).

	ACKNOWLEDGMENTS

 
The authors are grateful to E. Hänseberger for help in the preparation of the cryostat sections.

	FOOTNOTES

 

Address for reprint requests and other correspondence: J. Biber, Institute of Physiology, Univ. Zürich, Winterthurerstrasse 190, CH-8057 Zürich (E-mail: JuergBiber{at}access.unizh.ch)

The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

	REFERENCES

TOP ABSTRACT METHODS RESULTS DISCUSSION GRANTS REFERENCES

 

1. Arima K, Hines ER, Kiela PR, Drees JB, Collins JF, and Gishan FK. Glucocorticoid regulation and glycosylation of mouse intestinal type IIb Na-Pi-cotransporter during ontogeny. Am J Physiol Gastrointest Liver Physiol 283: G426–G434, 2002.[Abstract/Free Full Text]
2. Bacic D, Schulz N, Biber J, Kaislling B, Murer H, and Wagner CA. Involvement of the MAPK-kinase pathway in the PTH mediated regulation of the proximal tubule type lla Na⁺/Pi cotransporter in mouse kidney. Pflügers Arch 446: 52–60, 2003.[ISI][Medline]
3. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 7: 248–254, 1976.[CrossRef]
4. Capuano P, Radanovic T, Wagner CA, Bacic D, Kato S, Uchiyama Y, St-Arnoud R, Murer H, and Biber J. Intestinal and renal adaptation to a low Pi-diet of type ll Na-Pi-cotransporters in VDR and 1-OHase deficient mice. Am J Physiol. In press, 2005.
5. Cross HS, Debiec H, and Peterlik M. Mechanisms and regulation of intestinal phosphate absorption. Miner Electrolyte Metab 16: 115–124, 1990.[ISI][Medline]
6. Custer M, Lötscher M, Biber J, Murer H, and Kaissling B. Expression of Na-Pi cotransport in rat kidney: localization by RT-PCR and immunohistochemistry. Am J Physiol Renal Fluid Electrolyte Physiol 266: F767–F774, 1994.[Abstract/Free Full Text]
7. Danisi G and Murer H. Inorganic phosphate absorption in small intestine. Handbook of Physiology. Bethesda, MD: Am Physiol Soc, 1991, vol. IV, sect. 6, chapt. 12, p. 323–336.
8. Falkenstein E, Tillmann HC, Christ M, Feuring M, and Wehling M. Multiple actions of steroid hormones-a focus on rapid, nongenomic effects. Pharmacol Rev 52: 513–556, 2000.[Abstract/Free Full Text]
9. Hattenhauer O, Traebert M, Murer H, and Biber J. Regulation of small intestinal Na-phosphate cotransporter (NaPi type IIb) by dietary phosphate intake. Am J Physiol Gastrointest Liver Physiol 277: G756–G762, 1999.[Abstract/Free Full Text]
10. Hildmann B, Storelli C, Danisi G, and Murer H. Regulation of Na⁺-P_i cotransport by 1,25-dihydroxyvitamin D₃ in rabbit duodenal brush-border membranes. Am J Physiol Gastrointest Liver Physiol 242: G533–G539, 1982.[Abstract/Free Full Text]
11. Hilfiker H, Hattenhauer O, Traebert M, Forster I, Murer H, and Biber J. Characterization of a new murine type II sodium-phosphate cotransporter expressed in mammalian small intestine. Proc Natl Acad Sci USA 95: 14564–14569, 1998.[Abstract/Free Full Text]
12. Katai K, Miyamoto K, Kishida S, Segawa H, Nii T, Tanaka H, Tani Y, Arai H, Tatsumi S, Morita K, Taketani Y, and Takeda E. Regulation of intestinal Na-dependent phosphate cotransporters by a low-phosphate diet and 1,25-dihydroxyvitamin D3. Biochem J 343: 705–712, 1999.
13. Kayne LH, Argenio DZ, Meyer JH, Hu MS, and Jamgotchian DB. Analysis of segmental phosphate absorption in intact rat: A compartmental analysis approach. J Clin Invest 91: 915 -922, 1993.[ISI][Medline]
14. Kayne LH, Pham PC, Pham PT, and Lee DBN. Intestinal absorption of phosphate. In: Textbook of Nephrology (4th ed.), edited by Massry, SG, and Glassock RJ, 2001, p. 355–362.
15. Li YC, Pirro AE, and Demay MB. Analysis of vitamin D-dependent calcium-binding protein messenger ribonucleic acid expression in mice lacking the vitamin D receptor. Endocrinology 139: 847–851, 1998.[Abstract/Free Full Text]
16. Murer H, Forster I, and Biber J. The sodium phosphate cotransporter family SLC34. Pflügers Arch 447: 763–767, 2004.[CrossRef][ISI][Medline]
17. Segawa H, Kaneko I, Yamanaka S, Ito M, Kuwahata M, Inoue Y, Kato S, and Miyamoto K. Intestinal Na/Pi cotransporter adaptation to dietary Pi content in vitamin D-receptor (VDR) null mice. Am J Physiol Renal Physiol 287: F39–F47, 2004.[Abstract/Free Full Text]
17. Stauber A, Radanovic T, Stange G, Murer H, Wagner CA, and Biber J. Regulation of intestinal phosphate transport. II. Metabolic acidosis stimulates Na⁺-dependent phosphate absorption and expression of the Na⁺-P_i cotransporter NaPi-IIb in small intestine. Am J Physiol Gastrointest Liver Physiol 288: G501–G506, 2005.[Abstract/Free Full Text]
18. Stieger B and Murer H. Heterogeneity of brush border membrane vesicles from rat small intestine prepared by a precipitation method using Mg/ETGA. Eur J Biochem 135: 95–101, 1983.[ISI][Medline]
19. Tanaka Y and DeLuca HF. The control of 25-hydroxyvitamin D metabolism by inorganic phosphate. Arch Biochem Biophys 154: 566–574, 1973.[CrossRef][ISI][Medline]
20. Yamashita T, Hasegawa H, Yamazaki Y, Kawata T, Urakawa I, Shimada T, Takeuchi Y, Fujita T, Fukumoto S, and Nagano N. Involvement of FGF2–23 in abnormal vitamin D and mineral metabolism associated with renal insufficiency (Abstract). J Am Soc Nephrol 13: 284A, 2002.
21. Xu H, Bai L, Collins JF, and Gishan FK. Age-dependent regulation of rat intestinal type IIb sodium-phosphate cotransporter by 1,25-(OH)₂ vitamin D3. Am J Physiol Cell Physiol 282: C487–C493, 2002.[Abstract/Free Full Text]
22. Xu H, Collins JF, Bai L, Kiela PR, and Gishan FK. Regulation of the human sodium-phosphate cotransporter NaPi-llb gene promoter by epidermal growth factor. Am J Physiol Cell Physiol 280: C628–C636, 2001.[Abstract/Free Full Text]
23. Xu H, Uno JK, Inoue M, Xu L, Drees JB, Collins JF, and Gishan FK. Regulation of intestinal NaPi-IIb cotransporter gene expression by estrogen. Am J Physiol Gastrointest Liver Physiol 285: G1317–G1324, 2003.[Abstract/Free Full Text]

This article has been cited by other articles:

				J. Marks, L. J. Churchill, E. S. Debnam, and R. J. Unwin Matrix Extracellular Phosphoglycoprotein Inhibits Phosphate Transport J. Am. Soc. Nephrol., December 1, 2008; 19(12): 2313 - 2320. [Abstract] [Full Text] [PDF]

				S. Kirchner, A. Muduli, D. Casirola, K. Prum, V. Douard, and R. P Ferraris Luminal fructose inhibits rat intestinal sodium-phosphate cotransporter gene expression and phosphate uptake Am. J. Clinical Nutrition, April 1, 2008; 87(4): 1028 - 1038. [Abstract] [Full Text] [PDF]

				J. F. Collins, Z. Hu, P. N. Ranganathan, D. Feng, L. M. Garrick, M. D. Garrick, and R. W. Browne Induction of arachidonate 12-lipoxygenase (Alox15) in intestine of iron-deficient rats correlates with the production of biologically active lipid mediators Am J Physiol Gastrointest Liver Physiol, April 1, 2008; 294(4): G948 - G962. [Abstract] [Full Text] [PDF]

				C. A. Wagner, J. Biber, and H. Murer What goes in must come out the small intestine modulates renal phosphate excretion Nephrol. Dial. Transplant., December 1, 2007; 22(12): 3411 - 3412. [Full Text] [PDF]

				L. V. Virkki, J. Biber, H. Murer, and I. C. Forster Phosphate transporters: a tale of two solute carrier families Am J Physiol Renal Physiol, September 1, 2007; 293(3): F643 - F654. [Abstract] [Full Text] [PDF]

				K. B. Williams and H. F. DeLuca Characterization of intestinal phosphate absorption using a novel in vivo method Am J Physiol Endocrinol Metab, June 1, 2007; 292(6): E1917 - E1921. [Abstract] [Full Text] [PDF]

				K. Huber, R. Hempel, and M. Rodehutscord Adaptation of epithelial sodium-dependent phosphate transport in jejunum and kidney of hens to variations in dietary phosphorus intake. Poult. Sci., November 1, 2006; 85(11): 1980 - 1986. [Abstract] [Full Text] [PDF]

				J. Marks, S. K. Srai, J. Biber, H. Murer, R. J. Unwin, and E. S. Debnam Intestinal phosphate absorption and the effect of vitamin D: a comparison of rats with mice Exp Physiol, May 1, 2006; 91(3): 531 - 537. [Abstract] [Full Text] [PDF]

				L. V. Virkki, H. Murer, and I. C. Forster Voltage Clamp Fluorometric Measurements on a Type II Na+-coupled Pi Cotransporter: Shedding Light on Substrate Binding Order J. Gen. Physiol., April 24, 2006; 127(5): 539 - 555. [Abstract] [Full Text] [PDF]

				A. Stauber, T. Radanovic, G. Stange, H. Murer, C. A. Wagner, and J. Biber Regulation of Intestinal Phosphate Transport II. Metabolic acidosis stimulates Na+-dependent phosphate absorption and expression of the Na+-Pi cotransporter NaPi-IIb in small intestine Am J Physiol Gastrointest Liver Physiol, March 1, 2005; 288(3): G501 - G506. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in ISI Web of Science Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (15) Citing Articles via Google Scholar Google Scholar Articles by Radanovic, T. Articles by Biber, J. Search for Related Content PubMed PubMed Citation Articles by Radanovic, T. Articles by Biber, J.